NIA Mouse Gene Index (mm92)

Exon structure for U000076

chr1 +

Exon1 17135443 - 17135669
	GGAAGTCCTTTACGCAACAGGGGGCCTTGAGAAACCAAGGATGCTTGCTGCAGCAAGTGTCTGCAGAGAGCAGGCCAACCCATAAAGCTGCCTGAGTCCT
	TTCATGCGAAATGGCTCGGAGGCAGGACGAGGCGCGGGCCGGTGTGCCCCTGAGGGTTGAAGGCCCGCCGGACAAGGAGGTCCACCTCATTCTGTACCAC
	TGGACGCACTCCTTCAGCTCTCAAAAG
Exon2 17137017 - 17137209
	GTGCGCTTGGTAATTGCTGAAAAGGCACTGAAGTGCGAGGAACACGATGTAAGTCTGCCCCTGAGTGAGCACAATGAGCCTTGGTTTATGCGCTTGAACT
	CAGCTGGAGAAGTACCGGTCCTTGTCCACGGGGAGAACATAATCTGTGAGGCCACTCAGATCATTGATTATCTTGAGCAGACTTTCCTGGATG
Exon3 17141197 - 17141472
	gcgggccctcccctttagctggatcccactttggccctgatgctggacctccttttcctcaggctctgcttcatttttgtccctgcagttccttcagaga
	ggaacaattatgggtccgagtttttgactgtgagctggcaaccccataatccctcacttgatgccctgtctttctgctggaagtgggctctacaaatttc
	ctttcctcactgttaggcatttcatctaaggccccgccctctgagtcctgaacatctctcacctcctaggactttg
Exon4 17147042 - 17147215
	AAAGAACACCCAGGTTAATGCCCGATGAAGGAAGCATGTATTACCCACGGGTGCAGCATTACCGAGAGCTTCTTGACTCCTTGCCAATGGATGCTTACAC
	ACATGGCTGCATTTTGCATCCTGAGCTCACTGTGGATTCCATGATCCCCGCTTATGCAACCACAAGGATTCGCA
Exon5 17148490 - 17148584
	GCCAGATTGGTAACACAGAGTCTGAACTAAAGAAACTTGCTGAAGAAAACCCTGACTTACAAGAGGCATACATTGCCAAACAGAAGCGACTTAAG
Exon6 17150005 - 17150119
	TCAAAGCTGCTTGATCATGACAATGTCAAATACTTGAAGAAAATTCTTGATGAGTTGGAGAAGGTCTTGGATCAGGTGGAAACTGAATTACAAAGAAGAA
	ATGAGGAAACTCCAG
Exon7 17151208 - 17154352
	AGGAGGGCAACCAGCCTTGGCTCTGTGGAGAATCCTTTACACTGGCAGATGTCTCACTGGCTGTCACATTGCATCGGCTGAAGTTCCTGGGGTTTGCAAG
	ACGAAACTGGGGACATGGAAAGAGACCGAACTTGGAAACCTATTATGAGCGTGTCTTGAAGAGAAAAACATTTAACAAGGTTTTAGGACATGTCAACAAT
	ATATTAATCTCTGCGGTGCTGCCAACAGCATTCCGGGTGGCCAAAAAAAGGGCCCCAAAAGTTCTTGGCAGCACCCTTGTGGTTGGTTTGCTTGTAGGAA
	TGGGATATTTTGCATTTATGCTTTTCAGAAGGAGACTTGGCAGCATGATATTAGCACTTAGACCCAGACCAAATTATTTCTAGGTTTGTTGGGATCTGTG
	GTAGCAGCACACGGAATCACTCCACTAGACCCTCATCCACTTGTCCAGACCCAGTGAAGATTTAGCCTTGGCAATTAGTAGAGAGCATACTTTATATAAT
	TCACGGGGAGCTCATGTGGGAGAAGGAGCTAATGATATGtttttttcttctttctctctgtctctttctctttcttcctttctttttttGTAGACAACAT
	GACTTACTTCTAATCTATCCCTAAAGGCCAGTATAACTGCTGACAGATTGGGGGGAGGGAACCTTTGATGGAGATTGTTAGTTCATGTATGTTCTCAGGT
	ATTTTTTGAGAGGTTGTAATTAGGAGCAGACAGTAATAACAACCCATGATTGCTCATAGTGCCTCACCTGAGAGTGACTGCAGGTCTGGGTGTTGAACAG
	TTATAGGATTCCTCTGGGACTCAGAGGCATCTTTGTTATACTAGACAGAGTTCAGACACAAACAAGACATTGTACTGATTCATCTTTCACTAGCAGCTTT
	AGGCATAAGTAAAGGAGAAAATGAGAAAGGGGAGAAAGAAAATGAGAGAATGAAGTACATCCAGAACAGAGCAGTAGATGCTAACCTCCAGTGGCCTTCA
	TTGCTGCCCATGGTTGCCTCTCTCTTTGGGGAATTTCACATATACCTACTTGTGGTCATGTACCCTCCTTAACTCAGAACTTTTAGGGAGGAGAGGGCTG
	GGAAGTTAGTGGGGATAGTATACTGGGGAGAAACCTATGCACTGCATAGAAAACACTTCATTTGACCTTAATTATGAGTTACACTTGTTAATTTAATAAG
	ATTAAGTTATTATGCACTTGAATGAGATGCCCATTGAAACATATGTCTAGCACTTTTATGAATGTCTAAAAGGATAGTAGGGTAGTCTTCATGGCTCCCA
	TGGCCACGTGAGGTGCTCATCCTGTATATGATTGTCTTCAGTCCTGGGAACCTTGGCCTCGACAGCCCTATTTATGCATACAAGTAATATATAGATGAAT
	GTCTCAAGTAAATATGGCTTATGGATGGTAGTGGATAATTTGATGAGAACTAAATATGCTTAGTTTTATTTGGAGAGACTAGTACATTCATGCACAAACT
	GTTGGCCAGGCTTTGTATTTGTTTATGATTATTGACAGAGCTTTACATTAAAGAAAAAAGTAAAAGCTAGCATTAGATATTGACAGCTAATTTGGGAAAG
	GTAAAATATATAGCTAGCTAGATGTCCACCCATACTCATCCATGTGTGTTTAAATATTTGGGGGATATATCAGTCCATATGGAAGAGACGGTTCATGGAT
	GACCTAGGAATAGCCATCAGACTATAATGCATGATTTTTGCTCAGGACAAGCCTCCTATTAAAGCAGGGAGGCAGTTTTCCTGGAGCTGGCTGTCAAAGC
	CTTAGGAGAAGCTTCAAGAATCTGATGGGAAGCTTGTCCACAGACTGTGAGTAAAGAGAAAGTCTGCTTGGATGACCTCAGGTGAACTATGCACATGGCC
	AAAAAATGTACTGACGTTTATTAATAGGAAAATGTCACAACCAGCAAGCAATGGCTTTCTGATGATAAAAACAATTCTATAATTCCTTTTTGATTCTATT
	ATTCCATTTCATAAGCTAGATGTACTTAAAAAAAGAACCCATATGAGCAGGATGTGTCCTGTTTGTAAAAAACAAGCAAAACAGCAACATCAAAACAAAA
	AACCCTAACACCCCCATGTGAACTCAGATCTATGATGAGGAAATGCACGCAGCTTTTGTGCCATCTTCCTCTGCCCATCAATGTGTCATGCAGAGTGTCT
	GAATCTGCTTATTGCTAGGACATTGCTGTCATTGTATTTATACAACAGTCATAAAATTAACTGACTAGTGATTCAGAATTTCTTACAATGTTCTGATAGA
	AATAAAAAGTGAGGCACAAAGAAGTAACAATGGGAATTTTGTAAAAAAAAAAAAAAATCTACAAAAGGTACTTATTTACTTGTGAAAGGATTGTTAAAGA
	GTGAATTTTCTTTCAGTATATGTTATGATGGAGTCAGAAAATCACCAGGAAATTATGATTTTCATCTGTAATTTATTTGGAGGTAGATGTGTGCCAGTGT
	TCAAGGCGAGGCATCCAAGCCTCTTCAATGTTTTATAGGTAGGTATTCTTGACATTAGTGCTTTAAAAATATTTGTCTAGTGATAAAACCCTGACCACTA
	GATGTCGCTGTTCACCCAGTAGTCTAAGACTGTTCCATTTGGTTTGGCATGTGTGAGAGGTTTCAAGTGACGATAAAACATTAATGACCTTAGTTTCTGA
	GGGAATCTTCATTAAGATTAGCCACCTGTGAAAAAGTTTGGGACAAATGTAGTATTGATTTCTTATGCGTTGCGAGTGATGTCAGCACCGTATGATAAGG
	AGGTGCACAGCCACTGTTAGCCAGAGAGGCACTTTAATGCATCTTCTTTTTAGGATCATGGTAACTGGTCAATATGCTTCTCATGTGAAAAAAAAAAGTA
	TAAATGCCACAGCTAGAAAATGCCCAAGGCATTAACAGGTTATGTTGCCTATTTCTTAACATACATGCACACTATTTTATTGGTACTGCCATTATATGCC
	TTTTGATTCTCAAGACTGGTGAACTGCTTGCTCGTTTTAGTAATCATTGCTATTGATATCAAAGTTGTAATGTATTGTTGATTGTCATGGGAAATTAAAG
	ATATTATTCTGATGGTAAGATCAATAAAAATAATTTGAAAATAAA

Links between exon parts

From
exon
To
exon
Splice
sites
SupportExamples
12+35dbEST_BB642312.1,dbEST_CJ183965.1,dbEST_BB656307.1,dbEST_BY125062.1,REF_NM_010267.3,GB_AK149281.1,GB_AK083814.1,GB_AK045460.1,GB_Y17850.1,GB_AK020988.1,GB_BC048177.1,GB_BC060212.1,GB_AK049655.1,GB_BC051135.1,GB_AK139057.1,
24+27dbEST_BB642312.1,dbEST_BB656307.1,dbEST_BB643910.1,dbEST_BB593029.2,REF_NM_010267.3,GB_AK149281.1,GB_AK083814.1,GB_AK045460.1,GB_Y17850.1,GB_AK020988.1,GB_BC048177.1,GB_BC060212.1,GB_AK049655.1,GB_BC051135.1,GB_AK139057.1,
34+3dbEST_CA562211.1,dbEST_CA561726.1,dbEST_CA561810.1,
45+25dbEST_CO432681.1,dbEST_CN534886.1,dbEST_BY727086.1,dbEST_CB519004.1,REF_NM_010267.3,GB_AK149281.1,GB_AK083814.1,GB_AK045460.1,GB_Y17850.1,GB_AK020988.1,GB_BC048177.1,GB_BC060212.1,GB_BC051135.1,GB_AK139057.1,
56+23dbEST_CO432681.1,dbEST_CN534886.1,dbEST_CB519004.1,dbEST_CA328114.1,REF_NM_010267.3,GB_AK149281.1,GB_AK083814.1,GB_AK045460.1,GB_Y17850.1,GB_AK020988.1,GB_BC048177.1,GB_BC060212.1,GB_BC051135.1,GB_AK139057.1,
67+15dbEST_BG080860.2,dbEST_CV556864.1,dbEST_CO433853.1,dbEST_EL606268.1,REF_NM_010267.3,GB_AK149281.1,GB_AK083814.1,GB_AK045460.1,GB_Y17850.1,GB_BC048177.1,GB_BC060212.1,GB_BC051135.1,GB_AK139057.1,