NIA Mouse Gene Index (mm92)

Exon structure for U000561

chr1 +

Exon1 89406464 - 89406790
	GGGACTGGGTGCTAGTGACCTGGAACAGGACGCACGGCTCTCCCAGGGGGAAGGTCCGTCGGATTAGAGTTAGTGGGGGGCAGCAGGAGCCCGGGGGCCG
	AGGACCCGGATAGGCCGCAGGGGTCCGAGATCATCGCCTAGGGAGCGAGTGTGAGGGAGTACGTGGGGACATTGCGCGGGGGCCGGGATACAGCGGGTCC
	TCACCTGCCCGGCAGGTGTCCCGCCGCCGAGTCGCGCGTGTCGCTCTCCGAGGTGGAGCTGTCGTGGTCCACGGCGCAGGCGGCGCTGAAGGCTGCAGCC
	AGCAGCTCCATGGGGACCAGCGACCGG
Exon2 89470602 - 89470701
	GACATGACCCAAACGGCCCCTGGCTGCAAGGTAATATCGGAAGTTGACTAAGAATGGACGCCCCACCACTGACTGACCCGCCCCCTGAGTCTGAGATTGG
Exon3 89476009 - 89476110
	acttgtctctggatacagtcatactttgaggtactacaagttagaaactgttaggttactcagttcagtccatgacaGTCCAACCTTCTCCATGGTTTTC
	CG
Exon4 89480595 - 89480824
	GAAGGAAAGACAGAAGGGAAAGAAGAGGTGTCCCCACACTAGCTTTCTCTCATGGAGCTTGCCCCCAAAAATTGAGAGTGCACAAAAGAAAGAAATAAGA
	AATAGCCCAGCCCCTACTTTCTGGCTGTGCCAGCTGTCAGAGGCACAGAAAAGGTGTTGGGGGGGCACCCACTGAAGTCTCCAGATTCTCCTGTCTCAGG
	ACAAGGGACAGCACCAAGGACACATGGAAG
Exon5 89491125 - 89491192
	GGCAGTCGGATAGCTGCAGAGAGCCACTCAGCAAGCTCTTCTACTCTACCCAGGGCTAGCAGATGAAG
Exon6 89491453 - 89491664
	ATCTCAGGCCCATGGCGACCTGCCCTGTCCTGCAGAAGGAGACACTGTTCCGCACAGGCGTCCATGCTTACAGAATCCCTGCTCTGCTCTACCTGAAGAA
	GCAGAAGACCCTGCTGGCCTTTGCGGAAAAGCGAGCCAGCAAGACGGATGAGCACGCAGAGTTGATTGTCCTGAGAAGAGGAAGCTACAACGAAGCCACC
	AACCGTGTCAAG
Exon7 89493113 - 89494420
	TGGCAGCCTGAGGAAGTGGTGACCCAAGCCCAGCTGGAAGGCCACCGCTCCATGAATCCATGTCCCTTGTATGACAAGCAAACAAAGACCCTCTTCCTTT
	TCTTCATCGCTGTCCCTGGGCGTGTATCAGAACATCATCAGCTCCACACTAAGGTTAATGTCACACGGCTGTGCTGTGTCAGCAGCACTGACCATGGGAG
	GACCTGGAGCCCCATCCAGGACCTCACAGAGACCACCATTGGCAGCACTCATCAGGAATGGGCCACATTTGCTGTGGGTCCTGGGCATTGTCTGCAGCTG
	CGGAACCCAGCTGGGAGCCTGCTGGTACCTGCTTATGCCTACCGGAAACTGCACCCTGCTCAGAAGCCTACCCCCTTTGCCTTCTGCTTCATCAGCCTTG
	ACCATGGGCACACATGGAAACTAGGCAACTTTGTGGCTGAAAACTCACTGGAGTGCCAGGTGGCTGAGGTTGGCACTGGAGCTCAGAGGATGGTATATCT
	CAATGCTAGGAGCTTCCTGGGAGCCAGGGTCCAGGCACAAAGTCCTAATGATGGTCTGGATTTCCAGGACAACCGGGTAGTGAGTAAGCTTGTAGAGCCC
	CCCCACGGGTGTCATGGAAGTGTGGTTGCCTTCCACAACCCCATCTCTAAGCCACATGCCTTAGACACATGGCTTCTTTATACACACCCTACAGACTCCA
	GGAATAGAACCAACCTGGGTGTGTACCTAAACCAGATGCCACTAGATCCCACAGCCTGGTCAGAGCCCACCCTGCTGGCCATGGGCATCTGTGCCTACTC
	AGACTTACAGAACATGGGGCAAGGCCCTGATGGCTCCCCACAGTTTGGGTGTCTGTATGAATCAGGTAACTATGAAGAGATCATTTTCCTCATATTCACC
	CTGAAGCAAGCTTTCCCCACTGTATTTGATGCCCAGTGATCTCAGTGCACGTGGCCCAAAGGGCTTCCTTGTGCTTCAAAACACCCATCTCTCTTTGCTT
	CCAGCATCCTCTGGACTCTTGAGTCCAGCTCTTGGGTAACTTCCTCAGGAGGATGCAGAGAATTTGGTCTCTTGACTCTCTGCAGGCCTTATTGTTTCAG
	CCTCTGGTTCTCTTTTCAGCCCAGAAATCAAAGGAGCCTGGCTTTCCTCAGCCTGTTGGCAGGGCAGGTGGGGACAGTATATATAGAGGCTGCCATTCTG
	CATGTCGGTTGTCACTATGCTAGTTTAACCTGCCTGTTTCCCCATGCCTAGTGTTTGAATGAGTATTAATAAAATATCCAACCCAGCCCATTTCTTCCTG
	GAAAAAAA

Links between exon parts

From
exon
To
exon
Splice
sites
SupportExamples
16+3dbEST_CJ157521.1,dbEST_CX237085.1,ENSMUST00000166055,
23+4ENSMUST00000163606,ENSMUST00000172222,REF_NM_001160163.1,GB_FJ613504.1,
26+4dbEST_BY026109.1,ENSMUST00000166259,REF_NM_001160164.1,GB_AK145284.1,
36+4ENSMUST00000163606,ENSMUST00000172222,REF_NM_001160163.1,GB_FJ613504.1,
46+5dbEST_BY088515.1,ENSMUST00000164128,REF_NM_001160165.1,GB_AB048604.1,GB_AF139059.1,
56+6ENSMUST00000070898,REF_NM_015750.3,GB_BC105657.1,GB_BC105658.1,GB_BC105659.1,GB_AB028023.1,
67+26dbEST_CX237085.1,dbEST_BY026109.1,dbEST_BY246197.1,dbEST_BF584257.1,REF_NM_001160163.1,REF_NM_001160164.1,REF_NM_001160165.1,REF_NM_015750.3,GB_AK145284.1,GB_FJ613504.1,GB_AB048604.1,GB_AF139059.1,GB_BC105657.1,GB_BC105658.1,GB_BC105659.1,GB_BC105661.1,GB_AB028023.1,GB_AK009828.1,GB_BC026408.1,