NIA Mouse Gene Index (mm92)

Exon structure for U000603

chr1 +

Exon1a 93194915 - 93195003
	GCCCATTCAGAGACTTCGGGGCGCTCAGGCTTGGGGTGACCTGCCGGCGATCAGGGGGATGGACGCGGCGCGAAATGGCGCGCTGGGCA
Exon1b 93195004 - 93195025
	GTGTGGAGAGCCTACCCGACAG
Exon1c 93195026 - 93195077
	GTGCGCTCCCTTCAAGGAGCCCGCAGGGCCTAGGGACACCTGGGGGACCTCA
Exon2 93195642 - 93195764
	CCCCATAAGGCCTCGATATGTAGTCCAGGCTACTCCTGCCTTCTCCgatatggtggaacttgcctataatcccaacactgaggacaggaggattgtgatt
	tggaggccagcttggatcacaca
Exon3 93195981 - 93196046
	GAAGGAACAGACTTGGGACACAGGCAAAGCCTGCGGCAATGGGAATTCCAGCCCCAGGGTGGTCAG
Exon4 93196508 - 93196598
	GGGCCAGGCTGCGTGCGGCCTACAGTTTCCAATCGAACCCTGGAGCCTCATCCAAACAGATCTGCTGAAGCACAGACTTTAAAAAGTTTAG
Exon5a 93197088 - 93197104
	GCTATTCTCTCTTCCAG
Exon5b 93197105 - 93197217
	GAAGGTCTATATGGACTATAATGCCACCACACCTCTAGAGCCCGAAGTCATCCAGGCTGTGACAGAGGCCATGAAGGAAGCCTGGGGAAACCCCAGCAGC
	TCCTATGTGTCAG
Exon6 93199346 - 93199446
	GTAGGAAGGCCAAGGACATTATAAATGCAGCTCGAGCGAGCCTGGCCAAGATGATAGGTGGAAAGCCCCAGGACATCATCTTCACTTCTGGGGGCACCGA
	G
Exon7 93201014 - 93201045
	gtctccagcagaaggtgtggcccagattaaag
Exon8 93201851 - 93202031
	TCAAATAATTTAGTAATCCACTCTATGGTAAGATGCTTCCATGAACAGCAGACCCTGAAGGGGAACATGGTTGACCAGCACAGCCCAGAAGAGGGGACCA
	GGCCCCATTTTATCACTTGCACAGTGGAACACGACTCCATCCGGCTGCCCCTGGAGCACCTGGTGGAAAATCAAATGGCAG
Exon9a 93204870 - 93204890
	TATATATGTTTTGTATCTCAG
Exon9b 93204891 - 93205018
	AGGTCACTTTTGTCCCAGTGTCGAAGGTGAATGGGCAGGCAGAGGTCGAGGATATCCTGGCGGCTGTCCGTCCCACCACATGCCTTGTGACCATCATGCT
	GGCCAATAATGAGACCGGCGTCATCATG
Exon10 93205228 - 93205392
	CCTGTCTCCGAGATCAGTCGGCGAATTAAAGCCCTGAACCAGATCCGGGCTGCCTCGGGGCTGCCCCGAGTCCTGGTGCACACAGACGCTGCTCAGGCAC
	TGGGGAAGAGGCGAGTGGATGTCGAAGACCTGGGCGTGGACTTCCTGACCATCGTGGGACATAAG
Exon11 93206374 - 93206480
	TTCTACGGCCCCAGGATCGGTGCTCTGTATGTACGAGGGGTCGGTAAACTTACCCCCCTGTACCCCATGCTGTTTGGAGGTGGACAAGAGTGGAATTTCA
	GGCCAGG
Exon12 93212066 - 93212102
	GACCGAGAACACGCCCATGATTGCTGGCCTTGGGAAG
Exon13 93213641 - 93213724
	GCTGCTGATCTGGTGAGCGAGAACTGCGAGACTTATGAGGCCCACATGAGAGACATCCGAGATTACCTGGAGGAGAGGCTGGAG
Exon14 93214169 - 93214268
	GCTGAGTTTGGTAAGAGAATCCATTTGAACAGCCGGTTTCCAGGAGTGGAGAGGCTTCCAAACACCTGCAACTTTTCCATCCAGGGGTCCCAGCTTCAAG
Exon15 93215615 - 93215690
	GGTACACGGTCCTTGCACAGTGCCGGACACTGCTGGCCAGTGTGGGAGCATCATGCCACTCAAATCACGAGGACCG
Exon16 93216654 - 93217657
	GCCATCCCCAGTGCTGCTGAGCTGCGGCATTCCTGTGGACGTGGCCCGGAATGCAGTCCGGCTCAGCGTGGGCCGCGGTACCACCAGGGCTGATGTGGAT
	CTCATCGTACAGGACCTGAAGCAGGCCGTGGCCCAACTGGAAGGGCGGCTCTAGAACTAGCAGCCGCTCTCTGTAGCCAGCTGGACTTTTACCACTCGAT
	CCATAGGAAACCGCTTGCAAAAGCCCTTGGTCCCTAAGCTGCCCCATCTCAAGAGCTGCGTTGAGGTGACTTGTCCTACTGTGGGGTGCAGAGTGACGAG
	GGGCTGCCCACCGCACAGAATCCCACCCCAGCACCCATCCTTACAAGCTCAGGACAGCCATGTCACATAGGACTTCTCCCTGTCACCTTCTGACAAAGGC
	CACAGGGGAATAGGAATATTCCAGTTATCGGGCAGCCTGCCAGGACCGCCTGACCCCAGAAGGCACCTTGGTCAGAAGACAAAACCCAAGTCTTGGTCCG
	GTGTCACTTAGCTGCTAGTGTGAGAATAGGAAAGTTGATTTTGACTCCCCCTCCTACCCCCAACCCCCCACCCCCGTGCTTCCCCTGTGCACCTACAGAC
	ACACCCTTCTCCAGTGCAGCCCTGCCTCTGCCCTCAGCCAGCCACTGCCCACCTGCCTCCCTGGCCTGATGGTCCGCAGATGTCCCATGCCTTGTCCCCG
	GAAGTCGAAGCTTACCCTGCCTTCTACTCAGGGATCCACCTCCAGCGTGGTACCGGGAGGCTGGTGCCTGAGCTCAGTCTTTGCCAAAGTGGGAAATCTG
	ATCATTTCTCGCTCAGATTCCATTTTAATTTTATTTTGCAAAAGGCTGTGCCATCTTAAGGATGTGTGGCACACATCGCACCAAGGTTTATATAGGAATG
	TCTTCCTGGAGGCTGCTTTTTGGGTCTGTGGACCAAAGGATGACGCAACCCGTGAAAACAGTTGTCAGAAATTAAATGAACTAATGAAACATGTCTGCAC
	CTGC

Links between exon parts

From
exon
To
exon
Splice
sites
SupportExamples
1b3+2dbEST_CF950321.1,ENSMUST00000142488,
1b2+2dbEST_BY742202.1,GB_AK020864.1,
1b5a+1ENSMUST00000147523,
1b5b+91dbEST_BB629734.1,dbEST_BY178325.1,dbEST_BY233206.1,dbEST_BY174417.1,REF_NM_016717.3,GB_AK036750.1,GB_BC021389.1,GB_AK036533.1,GB_BC019879.1,GB_AF175407.1,GB_AK179665.1,GB_AK178608.1,GB_AK183254.1,
1c5b+4dbEST_AA107712.1,dbEST_AI385833.1,ENSMUST00000142802,GB_AK188684.1,
35b+3dbEST_CF950321.1,dbEST_BB848193.1,ENSMUST00000142488,
45b+2dbEST_BB863014.1,ENSMUST00000145843,
5b6+101dbEST_BB629734.1,dbEST_BY178325.1,dbEST_BY233206.1,dbEST_BY174417.1,REF_NM_016717.3,GB_AK036750.1,GB_BC021389.1,GB_AK036533.1,GB_BC019879.1,GB_AF175407.1,GB_AK178608.1,GB_AK183254.1,GB_AK188684.1,
67+2dbEST_BE310033.1,ENSMUST00000137074,
68+90dbEST_BB629734.1,dbEST_BY174417.1,dbEST_BY180991.1,dbEST_BB857408.1,REF_NM_016717.3,GB_AK036750.1,GB_BC021389.1,GB_AK036533.1,GB_BC019879.1,GB_AF175407.1,GB_AK179665.1,GB_AK178608.1,GB_AK183254.1,GB_AK188684.1,
78+2dbEST_BE310033.1,ENSMUST00000137074,
89b+40dbEST_BB629734.1,dbEST_BF180664.1,dbEST_CB953994.1,dbEST_BI559034.1,REF_NM_016717.3,GB_AK036750.1,GB_BC021389.1,GB_AK036533.1,GB_BC019879.1,GB_AF175407.1,
89a+2dbEST_BI332774.1,ENSMUST00000124832,
9b10+37dbEST_CB953994.1,dbEST_BI559034.1,dbEST_BI219626.1,dbEST_BQ109286.1,REF_NM_016717.3,GB_AK036750.1,GB_BC021389.1,GB_AK036533.1,GB_BC019879.1,GB_AF175407.1,GB_AK186846.1,
1011+18dbEST_BI666021.1,dbEST_BI413150.1,dbEST_BU707537.1,dbEST_CF618251.1,REF_NM_016717.3,GB_AK036750.1,GB_BC021389.1,GB_AK036533.1,GB_BC019879.1,GB_AF175407.1,
1112+13dbEST_BU707537.1,dbEST_CF618251.1,dbEST_CV560858.1,dbEST_BQ257249.1,REF_NM_016717.3,GB_AK036750.1,GB_BC021389.1,GB_BC019879.1,GB_AF175407.1,GB_AK206313.1,
1213+13dbEST_BU707537.1,dbEST_CF618251.1,dbEST_CV560858.1,dbEST_BQ257249.1,REF_NM_016717.3,GB_AK036750.1,GB_BC021389.1,GB_BC019879.1,GB_AF175407.1,GB_AK206313.1,
1314+14dbEST_BQ257249.1,dbEST_AW476596.1,dbEST_D77052.1,dbEST_BI412179.1,REF_NM_016717.3,GB_AK036750.1,GB_BC021389.1,GB_BC019879.1,GB_AF175407.1,GB_AK206313.1,
1415+14dbEST_BI412179.1,dbEST_CA977415.1,dbEST_BQ933092.1,dbEST_EL608436.1,REF_NM_016717.3,GB_AK036750.1,GB_BC021389.1,GB_BC019879.1,GB_AF175407.1,GB_AK206313.1,
1516+14dbEST_AW476596.1,dbEST_BI412179.1,dbEST_CA977415.1,dbEST_BQ933092.1,REF_NM_016717.3,GB_AK036750.1,GB_BC021389.1,GB_BC019879.1,GB_AF175407.1,