NIA Mouse Gene Index (mm92)

Exon structure for U000623

chr1 +

Exon1 94830953 - 94831591
	GGAAGGAGCGAAGCACGCTGGGAAGTAGACAACGCCTGTGATCAGCGACGTATGCTGGGAACGGCGCTGCATGCTGGGATAGCATTGACAAAGCGATCTA
	AACCAAAGTGACTTTTCAGCTTCCTGTGGTCACTGAGACTTCGATTTCAAGTGGCTACAGCTGCGTTGTCCCGAGCACTAAAGCATACGGACATCAGGCT
	AGCACTGCCCAGTTAGAAACGCGGGGACCACGCCCTCGTGCGAGAGCAGAACCTACCAGTCCTGCACGGTTCTGCGCTGCAGCTCGTGCGTGATTAGGCA
	GCTCTGTCATATGACGCAAGCACGGCTCCTGGTTGGCTCCAGCCGGGTTACCTAGACAACGGAGCTTGCGGCGCTAGGCTGCTCTGCACCAGTAGGTCTC
	CCGGGCTAAGCAAACACGGTTTGCAGTGAAGGCCGCGCACTCGCTCCCGGGCGGCGACCGAGTCCACGGGCCGCAGATGGGAGCCCAGGGCGCCGAAGAT
	GCGGGCGGTCCGGGCCGAGACGCCGGCGCGGGAGCTCTTCCGGGACGCGGCATTCCCCGCCTCGGACTCCTCGCTCTTTTACAACTTGTCCACGCCTCTG
	GCCCAGTTTCGGGAGGACATCACTTGGAGACGACCCCAG
Exon2 94834522 - 94834653
	GAAATCTGTGCCACACCTCAGCTGTTTCCAGATAACCCATGGGAGGGACAGGTGAAGCAAGGGCTGCTGGGAGATTGCTGGTTCCTGTGTGCCTGTGCCG
	CCCTTCAGAAGAGTCAACACCTCCTGGACCAG
Exon3 94835900 - 94836096
	GTCTTCCCTCCAGGACAGCCAGGCTGGTCTGACCAGAAATACCAAGGCTTCTTCACCTGTCGGATTTGGCAGTTTGGACACTGGGAGGAAGTGACCATAG
	ATGATCGTCTGCCTTGTCTTGCCGGGAGACTCTGCTTTTCCCGGTGCCAGAGAGAGGATGTGTTCTGGCTTCCCTTACTGGAAAAGGCCTATGCTAA
Exon4a 94836860 - 94837077
	GGTCCATGGATCGTATGAGCACCTGTGGGCAGGGCAAGTGGCAGATGCCTTAGTGGATCTCACTGGAAGCCTGGCAGAAAGGTGGAGCTTGAAGGATGTA
	ACGAAAGCCAGCGGCCAGCAGGACAGACCCAGTGGTGGGGAGCACAGAACTTGTCGGCAGCTACTCCACCTGAAGGACCGGTGTCTAATCAGCTGCTCTG
	TGCTTAGCCCCAGAGCAG
Exon4b 94837078 - 94837439
	GTACAGCTATGGCTACAACTCCCTCCACCATTAGCTTGTTACAGAGAAGGAAATCGGTCCTTGAGAGGCTGTCTTGGCTGGGTGTCCTCCTGTTACCCCT
	CCTCTAGAGAGAGGTTATCCTCTTTCTCCTAGACTAGTCCTTTCACGTAGGGCAAGGCGGGACCTACGTCATGTCCCCTGCTGCTCACAGCTTAGAAGCA
	GTAGCAAGAACAGCATCCAAGCTAGCCACATCATCACCCGTGCCCCAGTTGCTTACCAAGCAAAGTCCAAAGCCATTTTTATCTTCCTGATATATTAAGG
	TTCATGAGGAGAAGTTTGTGTACAAAATAAAGAAAAAAGAAAAGCTCACCTAGATAGAACTG
Exon5 94839059 - 94839200
	GTGCCAGGGAACTCGGAGAGTTCCATGCCTTCATCATCTCAGATCTGCAGGAGCTCAGGAGTCAGACTGGCCAGGGTATCCTCCTGCTGCGGATTCACAA
	CCCCTGGGGCCGGCGTTGTTGGCAGGGCCTCTGGAGAGAAGG
Exon6 94839877 - 94840043
	AGGTGAAGGGTGGAACCAGGTAGAGCCAGCTAAGGAGTCTGAGCTGCTGGCCCAACTCCAGGAAGGAGAGTTCTGGGTCGAGGAAGAGGAGTTCCTCAGG
	GAGTTTGATGAGGTCACCATCGGCTACCCAGTCACAGAGGCCGGCCACCTACAGAGTCTCCACACAG
Exon7 94840256 - 94840518
	AGAGGGTGCTGTGCCATACGCGGACACTGCCTGGTGCCTGGGTGACAGGGCAGTCAGCAGGAGGCTGCCGGAACAACAGTTGCTTTCCCTGCAACCCCAA
	GTTCTGGTTACGGCTCTTGGAACCCAGCGAGGTGTGTGTGGCTGTTCTTCAGAGACCCCGGAGGCGCTTAGTGGGCCAGACTCGGGCACTGGCGGGTGCC
	AGTCCTGCACCGGTGAACCTCCCAGGCAAAGACTACCAGGCTGTGGGCCTGCACATCTGGAAG
Exon8 94841272 - 94841474
	GTAGAGAAACGGAAGATCAGCCTGCCCAGAGTCCTGTCTGCACCCCCTGTGGCTGGCACTGCATGCCATGCGTATGATCGTGAGATCCACTTGCGTTGTG
	AGCTCTCACCAGGCTACTACCTGGCCGTCCCTAGCACCTTTTTGAAGGATGTGCCAGGGCAGTTCCTGCTCAGAGTCTTCTCCACTGGGAAAATCTCCCT
	CAG
Exon9 94841594 - 94841855
	TGCCGTCAGGCTGGCCACCAAGGGTGCATCGCCTGGAACAGCCCTGCCTGCAGGCGAGTGGGAGACTGTGCAGTTGCAGGGCTGCTGGAGAGCTGGCCAG
	ACAGCTGGGGGCAGCAGGAACTTTGCCTCTTACCCCTGCAATCCCTGCCTCCCTTTCTCTGTTCCTGAGGGTGCTGGCCCCCGCTACATCCGTATCACCC
	TACAGCAACACTGCCGGCTCAGTGACAGCCAGCTGCACCCCATTGGTTTCCATGTCTTTCAG
Exon10a 94843262 - 94843350
	GGCAGTACTCCCTTAGCTGGTGCTGTGCAGAGTGAGAGCAAACCATGCCACCCTGAATGGGCCTCCATGCCAATTGCACTGTTGCCCAG
Exon10b 94843351 - 94843550
	GTTCCAGCAGACGGTGAGAACCAGGACGCGTGTTCCCTGCTGCTCCAGGAGCCACTGCTAAGCTGTGTACCACATCGCTACGCCCAGGAAGTGAGCCGCC
	TCTGCCTCCTTTCTGTGGGGAACTACAGGATTGTTCCCTCCACCTACCTGCCAGATACAGAGGGTACCTTCACGGTAACCATAGCAACCAGAATCGATAG
Retained Intron 94843551 - 94843791
	GTAGGTCTCCAGGCCTTGGAGGCTAGCAGGGGTCAAGGCCCTCAGCATTGTAACTCTTTCTTCCCTATGAGCCTTGTGCTTGGCCTGCATGTCCAGGCTC
	TTGCCTTTCTAGCAGAGCCAAGAGGTGGGCCCATGGACTTTGAGACTCCCTGCTGGTCTAAGCCTGGGAGTAGGGCCTGGGTCTGGTGGGAGGTCTGTCT
	GTGAGGCAGTTTTGGGAGATGACTAGATATTCTCTCCACAG
Exon11b 94843792 - 94843837
	GCAGTCCATCCACAGCCAGGAGATGCTGGGCCAGCTGCTCCAGGAG
Exon12 94844086 - 94844525
	GTCTCCTTTATGGCAGTGATGAAAGCCTGACACGAGACCCTGTGTGCCAGCCATGGCCAGAGTGGCTGCTGCCCCTGTGCCCAGCATCCAGGTGCATCTC
	CAGCCAGCTACAAGCCAGCTTCTCGTCAGCTCTGGAGGTTGGCTGTGGACCTTGGGGCTAAAATAGGGTGCTTTGTCCTGGATTGAAGACATCTCGGGTC
	CAGTGGGTGCTGCAGGGCGGGGCTAGAACTCCCAAGTGGTATCTTCATTCCTTAGTGAAGGCCAGGAGATTCCTGGGGCCCGGGTTTGTTGTGGAAAGCT
	TTGCAGAATCCACATAACCTTCTTGACTTCGGAAGCCTTACACTAGGCAGGCAGACTGTGACAAATGCTAAAACCTATTTATTACTTGAAATATTTTTGG
	AATGTGACTTTATAAATAAACATGAATAATTTATGGATTA

Links between exon parts

From
exon
To
exon
Splice
sites
SupportExamples
12+82dbEST_BI656119.1,dbEST_BG864497.1,dbEST_CX562066.1,dbEST_BY014870.1,REF_NM_011796.2,GB_AF089089.1,GB_AK013497.1,GB_BC010969.1,GB_AK088207.1,GB_BC005681.1,GB_AK002548.1,GB_AF126867.1,GB_AK185132.1,
23+55dbEST_BG864497.1,dbEST_CX562066.1,dbEST_CX205894.1,dbEST_CB589355.1,REF_NM_011796.2,GB_AF089089.1,GB_AK013497.1,GB_BC010969.1,GB_AK088207.1,GB_BC005681.1,GB_AK002548.1,GB_AF126867.1,
34a+45dbEST_CX205894.1,dbEST_BQ947567.1,dbEST_BG173787.1,dbEST_BF233607.1,REF_NM_011796.2,GB_AF089089.1,GB_AK013497.1,GB_BC010969.1,GB_AK088207.1,GB_BC005681.1,GB_AK002548.1,GB_AF126867.1,GB_AK219458.1,
4a5+23dbEST_BQ715644.1,dbEST_BU053664.1,dbEST_BU059171.1,dbEST_CF172973.1,REF_NM_011796.2,GB_AF089089.1,GB_BC010969.1,GB_AK088207.1,GB_BC005681.1,GB_AF126867.1,GB_AK184224.1,
56+22dbEST_CF950309.1,dbEST_BQ573552.1,dbEST_CF730749.1,dbEST_CO424971.1,REF_NM_011796.2,GB_AF089089.1,GB_BC010969.1,GB_AK088207.1,GB_BC005681.1,GB_AF126867.1,GB_AK184224.1,
67+21dbEST_CF950309.1,dbEST_BQ573552.1,dbEST_CA750030.1,dbEST_BF166926.1,REF_NM_011796.2,GB_AF089089.1,GB_BC010969.1,GB_AK088207.1,GB_BC005681.1,GB_AF126867.1,
78+14dbEST_BM948381.1,dbEST_BF012157.1,dbEST_BF012190.1,dbEST_AI508641.1,REF_NM_011796.2,GB_AF089089.1,GB_BC010969.1,GB_AK088207.1,GB_BC005681.1,GB_AF126867.1,
89+15dbEST_BM948381.1,dbEST_BE647626.1,dbEST_BQ831613.1,dbEST_AA571866.1,REF_NM_011796.2,GB_AF089089.1,GB_BC010969.1,GB_AK088207.1,GB_BC005681.1,GB_AF126867.1,
810b+1ENSMUST00000152983,
910b+12dbEST_CA577500.1,dbEST_AW209878.1,dbEST_AA120681.1,dbEST_CB057352.1,REF_NM_011796.2,GB_AF089089.1,GB_BC010969.1,GB_AK088207.1,GB_BC005681.1,GB_AF126867.1,
10b11b+22dbEST_AA120681.1,dbEST_CB057352.1,dbEST_CB055452.1,dbEST_AA027663.1,REF_NM_011796.2,GB_AF089089.1,GB_BC010969.1,GB_AK088207.1,GB_BC005681.1,GB_AF126867.1,
11b12+27dbEST_AA120681.1,dbEST_CB057352.1,dbEST_CB055452.1,dbEST_AA027663.1,REF_NM_011796.2,GB_AF089089.1,GB_BC010969.1,GB_AK088207.1,GB_BC005681.1,GB_AF126867.1,