NIA Mouse Gene Index (mm92)

Exon structure for U001088

chr1 +

Exon1 173341444 - 173341571
	ACACTTCCGCCCCTCACCAACATGGCCGCAGGCTGGGACTGCGCATGAGCAGCTGTCTATGGAGAGACCTAGATCCAAAGACGGAGAAGGCTGCCGGGGG
	AAATCGGCGACTGAAGCGGCCTGGCCCG
Exon2 173341812 - 173341993
	AAGGTCCCCGGCGTCCTTTCCCCGTCTCTCCTCCGCGGAGCAGCTGGGGCGCAGGCGAGCTGGGCTGGGACCGGCGGGGTCACCGCGCGGGCTGCGGGGC
	TCGCGCCTGCCGGGTACTCAGGTCCCCAAGCGCCTACTACTAGTCGGTGGGCCTGCAGGGAGACGCGTCGTTCTCGGGCAAG
Exon3a 173344504 - 173344567
	GTTCTAGAACCTGGAAAGCTGTTCAGTTGCCTGGCCTCACTGCAAACTCTGTGGTTTCCACCAG
Exon3b 173344568 - 173344660
	GACTTAGCATTCAGGCCTTTGAGTTGGGAGATACAAAGTCCTCCGAAAAAAGACCGGCGCCTCGGATGAGCCCCCTCACAGAGAGATGAAGGG
Exon4 173345636 - 173345685
	GCAGCAGAAAACAGCTGAAACCGAAGAGGGAACAGTGCAGATTCAGGAAG
Exon5a 173345822 - 173345845
	ATCTTTCTTTGCCTCTTAATCTAG
Exon5b 173345846 - 173345868
	GCGCAGTGGCTACTGGAGAGGAC
Exon5c 173345869 - 173345930
	CCAACTAGTGTAGCTATCGCCAGCATCCAGTCAGCTGCCACTTTTCCTGACCCCAACGTCAA
Exon5d 173345931 - 173345961
	GTACGTCTTCCGAACTGAGAATGGGGGCCAG
Exon6 173346266 - 173346367
	GTGATGTACAGGGTGATCCAGGTGTCAGAGGGGCAGCTGGATGGCCAGACAGAGGGCTCTGGCGCCATCAGTGGTTACCCTGCCACTCAGTCTATGACCC
	AG
Exon7 173346941 - 173347136
	GCAGTGATCCAGGGAGCTTTCACCAGTGACGATGCCGTTGACACGGAGGGAGCAGCTGCTGAGACACATTATACATATTTCCCCAGCACCGCAGTGGGAG
	ATGGGTCAGGGGGTACCACATCTGGGAGTACTACAGCTGTTGTTACCACCCAGGGCTCAGAGGCACTACTGGGGCAGGCAACCCCGCCCAGCACAG
Exon8 173347373 - 173347460
	GTCAATTCTTTGTGATGATGTCACCACAAGAAGTATTGCAGGGAGGGAGCCAGCGATCGATTGCCCCCAGGACCCACCCTTATTCCCC
Retained Intron 173347461 - 173347603
	GTGAGTGACCTTATCTGTTGTTAAGAGTGGTTTCGGTGCCTGCCAAACCTTACGTAATTCCTCACCCCAAACACCGGTCTTGGTTTCGTTTGCTTCTTTG
	CCTTTTCCTTGGTCTGGCCACCCTGGACTTGGACTATTATCAG
Exon9b 173347604 - 173347662
	GAAGTCAGAGGCTCCCAGGACAACTCGAGATGAGAAACGGAGGGCTCAACATAACGAAG
Exon10 173347772 - 173347995
	TGGAGCGCCGCCGCCGGGACAAGATCAACAACTGGATTGTACAGCTGTCCAAAATCATCCCAGACTGCTCTATGGAGAGCACCAAGTCTGGCCAGAGTAA
	AGGTGGAATCCTGTCCAAAGCCTGTGATTATATCCAGGAGCTGCGGCAGAGCAACCACCGGCTGTCTGAAGAGCTGCAGGGGTTAGATCAGTTGCAGCTG
	GACAACGATGTGCTCCGGCAACAG
Retained Intron 173347996 - 173348162
	GTCAGACTAACTCCAGGATGGCCCCCTTGGCAGCCCCGTAGCCACTGACCCAGTTTGGAGTCCCTGGAAAACACTTGCCATTGTCCCTCTTGGCTGTGGC
	TGTGGGGCTGAGTTCATGGCTTAGCGGTGTCAATCTTGTTTTTCCTCATCATTTCCTCTCCGTGCAG
Exon11b 173348163 - 173349266
	GTGGAAGATCTCAAGAACAAGAACCTGCTCCTGCGAGCTCAGCTTCGGCACCACGGACTCGAGGTCGTCATCAAGAATGACAGCAACTAACTCTGGGGAC
	TCAGGGGCTTTGGGCCAAGGACTGCAGCCGGCCCAGGAGCAACAGGCTAACCCCATGCCCCTCTCCTTCACTGCCTCCTCTGGCATGGGACTCGGGGGAG
	TTTGGCAAGTGTGTTTTTGAACTGAGGCCCTGTGGCGTGGCAGTCTGCAGTGAGTGGTGTGAAACAAACAGTGTGGGCGTGCACTGACAGCCCGGCCTGC
	TCCCTCTGTGCAGTCCCCGGGTCTGGTGCGCCTTCGGCACACTGCATGTGCTGTCTCCTTGCTGGACACTGGACACACTGAATCTGGGCTTGCCGTGTGC
	TCGCTTGGAGTGCCTGAGAGAGGGACTGCGGGCCTAGTACTTCCACTGGCTCTTCCTTTCTCTGGAGCAGAAGTTAAGATGCGTACCTGAGTACTCTGGG
	AAGCAGGCTTACTCAAGAGGTGGGAAAGGATGCTAGCTGGCTGCTATCCCAGGAGTAGAAGGGGGCCCAATGAGCAGCCGAGGCCCCTACGGAAGGCTCT
	GGAGCCAGGGAGAACTGTAGGCAGGGGTGGGTTCACTGAGAGCCTTCCCTGCTCCAGGGATGGGTCtttttatttctttccttttttttttttttttttt
	tttAAAGATAAAATTGTTTAGAGCCACAGTTGTCTGTCTTCCTCCTTTTTGGGGCCCTGGGGGAAGGGAGAGTGCATATTACTCTTTGACCAGTAAGGGC
	TGGGTCAACCTTTGAGTGGGGTGCTGCTGTTCCTATACTCATTACCCAGAGTCCTGGTGCCTGTGCCAAACCTGGGTGAAATTTCCGGCCTAACCTGGGC
	AGTCTATAAAGGTTTCAACTGTGTGCGAGTGTTACAGGTATCACCAACTGGTGCGATTGGACTCTGTGTGTGTATACTCCAGGGGCCATGCCCTTGCTTC
	CGGTTCCGGTCTCTGGTTGGGCTCTGGGAGGGTGAGGGAGATGCTTCGGCTTGCAGTTCTGCGTCACAGTCACACAAGTGCGGCTGCAGGAACCATGGCT
	GGAG
Exon12 173349469 - 173349591
	TGCCTACAGTCTCCTTCTCTGAGCTCCGTTCACTCGTAGCCTCAGGCAGGGCCAGGCTCTTCGACGTTCGATCTCCAGAGGAGGCAGCAGCTGGTACCAT
	TCCTGGGGCACTCAACATCCCTG
Exon13 173350069 - 173350231
	TGTCTGAATTGGAAATCGCCTTGAACATGGACCCAGCTGCTTTTCAGACTCTGTACTGTGCTGAGAAGCCAAAGCTAGAAGACAAGAATCTTATTTTCTT
	CTGTCAGATGGGCAGGCGGGGTCTCCAGGCCACACAACTGGCACAAGGTCTTGGCTATACAGG
Exon14 173350322 - 173350483
	GGCTCGGAACTATGCCGGGGCCTATAAAGAGTGGCTGGAGAAACAGGGCTAGATAAAAGGCTCACCAGTTTGTGGCTGTTCTCAGACTACCTTGCTGGGC
	TAGGCAAATCCTTGTAGTGCTTCACACATGAAAAACTCAAATAAAAAGTACACTTAATGAAG

Links between exon parts

From
exon
To
exon
Splice
sites
SupportExamples
13a+5dbEST_CJ050979.1,dbEST_CF171019.1,dbEST_DV660101.1,ENSMUST00000159207,
13b+41dbEST_CA951530.1,dbEST_BY057566.1,dbEST_BY055886.1,dbEST_BY051977.1,GB_AK142437.1,GB_BC049784.1,
23b+2ENSMUST00000167546,REF_NM_009480.2,
3b4+51dbEST_BY057566.1,dbEST_BY055886.1,dbEST_BY051977.1,dbEST_CJ050979.1,REF_NM_009480.2,GB_AK142437.1,GB_BC049784.1,
45b+48dbEST_BY057566.1,dbEST_BY055886.1,dbEST_BY051977.1,dbEST_CJ050979.1,REF_NM_009480.2,GB_AK142437.1,GB_BC049784.1,GB_AF479773.1,
45a+2dbEST_BY035725.1,ENSMUST00000161297,
5c6+12dbEST_BY055886.1,dbEST_BY051977.1,dbEST_AV463817.1,dbEST_BQ559569.1,GB_AF479773.1,
5d6+31dbEST_CJ050979.1,dbEST_CN688954.1,dbEST_CJ065485.1,dbEST_AL361028.1,REF_NM_009480.2,GB_AK142437.1,GB_BC049784.1,
67+35dbEST_CJ050979.1,dbEST_CN688954.1,dbEST_CJ065485.1,dbEST_CX565565.1,REF_NM_009480.2,GB_AK142437.1,GB_BC049784.1,GB_AF479773.1,
78+24dbEST_CX565565.1,dbEST_BU511990.1,dbEST_DV653810.1,dbEST_DV649678.1,REF_NM_009480.2,GB_AK142437.1,GB_BC049784.1,GB_AF479773.1,
89b+23dbEST_BU511990.1,dbEST_DV653810.1,dbEST_DV649678.1,dbEST_AA717587.1,REF_NM_009480.2,GB_AK142437.1,GB_BC049784.1,GB_AF479773.1,
9b10+23dbEST_BU511990.1,dbEST_DV649678.1,dbEST_CX214311.1,dbEST_BQ956037.1,REF_NM_009480.2,GB_AK142437.1,GB_BC049784.1,GB_AF479773.1,
1011b+17dbEST_CX214311.1,dbEST_BQ956037.1,dbEST_CX218976.1,dbEST_AI048462.1,REF_NM_009480.2,GB_AK142437.1,GB_AF479773.1,
11b12+12dbEST_BY076833.1,dbEST_BY099843.1,dbEST_BY093649.1,dbEST_DV052898.1,REF_NM_001164525.1,
1213+11dbEST_BY099843.1,dbEST_BY093649.1,dbEST_DV052898.1,dbEST_DV050517.1,REF_NM_001164525.1,
1314+22dbEST_BY093649.1,dbEST_DV052898.1,dbEST_DV050517.1,dbEST_BY720852.1,REF_NM_001164525.1,