NIA Mouse Gene Index (mm92)

Exon structure for U001513

chr2 +

Exon1 26170869 - 26171240
	TTGTCCACACTAGAGCAGGACTCTCCTTGCACTGGACCTCAAAGACAGAGCCCCGCCCACCCCACGGTAGGCGGGACCGCCGCAGTGGTGGCCGGTGGGC
	GCCTGCCCCTCCCCACCCTCCCTCCGCCTGGCGGCGGTGACATCACAGCTCTGGCGGGAGGGGCGGCGGCACCCCAGCACATCACTTCCTCGGCGTCTCC
	CgcggacgcgcggacaggcggacggacgcgcggacaggcgggcagatcggcaggcggacggCCGCAGAGCGGGGCGGTGCTCCTGCTCGGCGCGTCCCCG
	ACTCATGGCGAGCCCGGCCCCGCCCGTGGCCGAGGAGCTCCCGGGCCCGGCCTCCAGGCGCCTCTACTCCAG
Exon2 26175289 - 26175557
	CAGAGGAGCTGTTGGAGAGCTCGGGGTCTCCTGTAGCCTAGCCTGAAGATCCTGAGATTGGCGTGTCCCCTGGGACTTTTGCCAGAGCTCTGTGATGCTG
	GCTTCTGCTATGGAGGGCCAGCCTCTGGCCCTGAGCTTGGCAGAGAAGGCTGTGTGCAAGGTGGTATATGGTGCCCCTCGCCCTCGCCCATTGCTGCTGC
	CCGTGGGCCTGGAGCTGTGGCTGTATGTACAGAAGATGCGTAACCTCCAGAGAAAGAGGTGGGGACCAG
Exon3 26177934 - 26178155
	GATGGAGGCCTCCTGTCTAGAGCTGGCCCTGGAAGGGGAGCGGCTGTGCAAGGCGGGGGACTTCAAGGCAGGTGTGGCTTTCTTCGAGGCTGCTGTGCAG
	GTGGGCACTGAGGACCTGAAGACACTGAGTGCCATCTACAGCCAGCTGGGCAATGCCTACTTCTACCTGAAGGAGTATGCCCGGGCCCTGCAGTTCCACA
	AACATGACTTGCTGCTGGCACG
Exon4 26179028 - 26179163
	GACCATTGGTGACCGCATGGGGGAGGCCAAGGCTAGTGGGAACCTGGGCAACACACTCAAGGTCCTAGGCCGATTCGATGAGGCAATCGTCTGCTGCCAA
	CGACACTTGGACATTGCCCAGGAGCAGGGGGACAAG
Exon5 26179409 - 26179551
	GTTGGGGAGGCGAGAGCACTCTACAACATTGGAAATGTGTACCACGCCAAGGGCAAACAGCTTTCCTGGAATGCTGCACAGGACCCCGGGCACCTGCCAC
	CTGATGTCCGCGAGACACTGCACAGGGCCTCTGAGTTTTATGA
Exon6 26179933 - 26180056
	GAGGAACCTGTCTTTGGTGAAGGAACTAGGCGACCGGGCGGCCCAGGGCAGGGCCTATGGCAACCTGGGTAACACCCACTACCTACTGGGAAACTTCACG
	GAGGCCACAACCTTCCACAAAGAG
Exon7 26180318 - 26180433
	CGCCTGGCCATCGCCAAGGAGTTTGGGGACAAGGCAGCTGAGCGGAGGGCCTACAGCAACCTGGGCAATGCTCACATCTTCTTGGGGCGCTTTGATGTGG
	CTGCTGAACATTACAA
Exon8 26180857 - 26181012
	GAAGACGCTGCAGCTGTCTCGGCAGCTCCGGGACCAGGCAGTGGAGGCTCAGGCTTGCTACAGCCTGGGCAACACCTACACACTGCTACAGGACTACGAG
	CGTGCTGCTGAGTACCACCTGCGGCACCTAGTCATTGCCCAGGAGCTGGCTGATAG
Exon9 26181734 - 26181842
	GGTGGGAGAGGGCCGAGCATGCTGGAGCCTGGGGAACGCCTATGTGTCCATGGGGAGCCCTGCACAGGCCTTGACCTTTGCCAAGAAACATCTGCAGATC
	TCCCAGGAG
Exon10 26182812 - 26182935
	ATTGGAGACCGAAACGGAGAACTGACAGCCCGCATGAATATTGCCCACCTGCAGCTGGCCCTGGGCCGGCTGACTAGCCCAGCAGCAGCGGAGAAGCCAG
	ATCTGGCTGGCTATGAGGCACAAG
Exon11 26185911 - 26186085
	CCTCCCCACAGGGCTTCTTGCCGCCAACGGCTGGGCCCTGGACACTGGAGAATAGTCTATCCTCCAAGGAGGACATCAGAGAGGGCTCTGGTACCCCGAA
	GTTCTGGGATGCAGTTGCTGAAGGCAGGCCAGCACTCTGAGAGTCTGAGTGGTCCCGAGGGAGACTCCTACTCAG
Exon12 26195156 - 26195226
	GAGCAAGACCCAAACGGACACAGAGGCTGAGTGCCGAGACCTGGGACCTGCTGCGGCTCCCCCTGGACCGG
Exon13 26195925 - 26196104
	GAGCAGAATGGAGAGACCCACCACACAGGGGACTGGAGGGGTCCAGGCAGGGACTCGCTTCCCCTCCCCATGAGGAGCAGGAAGTACCAGGAAGGTCCAG
	ATGCCATTGAGAGGAGACCCCGGGAGGGTAGTCACTCTCCACTGGACAGTGCTGATGTAAGGGTACAGGTGCCTCGTACG
Exon14 26197714 - 26197950
	AGCACTTGTGAGCTGCAGCAGCGAGGGCGGGTATTGGGAGAGCCCAGCCTTCTCCCTAGCTCCTATTTAAGCATCAGGCGAAGACCGTGAGTCCCAGGAA
	CGGTGAGGAGGCACTTGGCACTTGGGACAGGTGGTAGCAGCTGTGCCTGACACCTTGGCATCCTGCCTGGGCTACACGTGGCCTAACACCCACACAGTTC
	CTGATTGCTGCGACTGGAGGGAACCTGTGATCCTGCT
Exon15 26200122 - 26200278
	GGTATTCCCAGGGCCCCGTCTTCTGACGAGGAGTGTTTCTTTGACCTGCTGAGTAAGTTCCAGAGCAGTCGCATGGATGACCAGCGCTGTCCCCTGGAGG
	AAGGCCAGGCTGGGGCTGCTGAGGCCACAGCTGCCCCATCCGTGGAGGATAGAGCAG
Exon16 26200671 - 26200879
	CTCAGTCCTCCGTGACAGCTTCACCACAGACAGAGGAGTTCTTTGACCTCATTGCCAGCTCCCAGAGCCGCCGGCTGGACGACCAGAGGGCTAGCGTAGG
	CAGCCTGCCTGGGCTACGCATCACCCTCAACAATGTGGGGCACCTCCGAGGCGACGGGGACGCCCAGGAGCCGGGGGATGAGTTTTTCAACATGCTTATC
	AAATACCAG
Exon17a 26202327 - 26202914
	TCCTCCAGGATTGATGACCAGCGCTGCCCACCCCCTGATGTGCTGCCCCGTGGCCCTACCATGCCTGATGAGGATTTCTTCAGCCTTATCCAGAGGGTGC
	AGGCTAAGCGGATGGATGAGCAGCGTGTGGACCTTGCTGGGAGTCCAGAGCAAGAGGCCAGTGGGCTGCCTGATCCCCAGCAGCAGTGTCCACCGGGTGC
	CAGCTAAGGCCTCGCCCCTACAGCCAGCCATACCCTACTCTGGACTCTGTAGGCTCACGGTTGTCCACAGTGGCCATGATCCCCCAATAAGCCAAATCTT
	CCCAAGGCCATGATGGACAGCCAGCTCAGCCCCAGCCCCTTCCCACTGAGCCAGATGGTGGGTGCACAAGGCCCCCCCATCCCAGGTGGTGGGTGCAGGC
	TAGAGCTGCTATATGGGGGAGGGCATGCTTCTGTCCCCATGGATCTCCACAGCTTCCTGCAGGCCTGCCCTGCCCTGCCCTAGGCCGGGCCTTCAGCATG
	TTGGCCCCGAGCCCCGGTGCTGTCCAGAGTCTTTTCCCTCAAGCCCTGCCCTGCCAAATGTGAAACTCTGCCAACTCTCCCAAGGCCC
Exon17b 26202915 - 26203544
	CCAGAGGGGCTTCAAGGACTTCTTCTGGTGGGGGCTACAGTGCTAAGGCATCTTCTGTCCCCCAGCTGGTCCTGGGATGGCTATGAAGGAGGTACACTCT
	GATCTGCCTCACGACCCCAGGGCAGGCACTATCCTGGCCTGGCTGTGCCCAACCCTGCTGAGGGAGATTGGCAGCTACAAAGTCCAGACACCCTGACCTG
	GTAGTCCCCAGCCTTGCACTTGGCCTTTGAGGAAAGATGGAGCTTGCCCCTGGCAGAGGGGAGAGGCAGGTCTCCAAGCATAGGGTCTTGTACTAGGAGT
	GCTGAGCTCTGGCTGGTAGTGGACGTTCATGAGGGATCCTCTCAACTAGATCCTTCAGTCCTCTTAGTGAGCATCTACCTTCTATTACTAGGGAGATGAT
	ATCTTGGCTTTCTCCCCAAGGAGGGGTCCATATCTTAATTGGACACAGGGCACTGTAGTTGGGGTGGAGACTCAGCCAGAACTGCCGGGGCATCCATGAG
	ACAGACCCTTCGGGACCGTGGTCCTAGTTCTTGCCTACAAGTCCTATAGGTAGCCCTACTGGAGGGCTCTGTACAACTGTCTAACCCAGGGCCTCTTACC
	CAGAGGGCCAGGGCAAGGGAAACTGAGGAC
Exon17c 26203545 - 26203757
	CCAACTTCTGAGAGGGAGAGGCAACATCACTCTGAGAGCAGAAACAGATACTAGAGCACAGGGTCTCGGGCGGGACATGGTGGCCGCCCCGCATACTTGA
	ATGTACATGCGTATTTATTGCTTACATGTGTTTGCCATGTTGTTCATGGGTCCTTTCTGACCCGAGAGGTACATTTGTTTTGTTTTACCCAAAAATAAAA
	GTCTGCCAAGTGA

Links between exon parts

From
exon
To
exon
Splice
sites
SupportExamples
13+36dbEST_CJ091545.1,dbEST_CA317518.1,dbEST_DN176602.1,dbEST_BY074436.1,REF_NM_001199146.1,REF_NM_153410.5,GB_AK048691.1,GB_AK084631.1,GB_AK082985.1,
23+2dbEST_CV783550.1,dbEST_CX564480.1,
34+43dbEST_CA317518.1,dbEST_DN176602.1,dbEST_CJ176267.1,dbEST_BB663154.1,REF_NM_001199146.1,REF_NM_153410.5,REF_NM_001199147.1,GB_AK048691.1,GB_AK084631.1,GB_AK082985.1,GB_BC071197.1,GB_BC026486.1,GB_AK190316.1,
45+43dbEST_CA317518.1,dbEST_BB663154.1,dbEST_CV562588.1,dbEST_BU610918.1,REF_NM_001199146.1,REF_NM_153410.5,REF_NM_001199147.1,GB_AK048691.1,GB_AK084631.1,GB_AK082985.1,GB_BC071197.1,GB_BC026486.1,GB_AK190316.1,GB_BC027004.1,
56+38dbEST_BU610918.1,dbEST_BM944551.1,dbEST_BM950432.1,dbEST_BB643915.1,REF_NM_001199146.1,REF_NM_153410.5,REF_NM_001199147.1,GB_AK048691.1,GB_AK084631.1,GB_AK082985.1,GB_BC071197.1,GB_BC026486.1,GB_BC027004.1,
67+31dbEST_CA889311.1,dbEST_CX566436.1,dbEST_CV784611.1,dbEST_BU053811.1,REF_NM_001199146.1,REF_NM_153410.5,REF_NM_001199147.1,GB_AK048691.1,GB_AK084631.1,GB_AK082985.1,GB_BC071197.1,GB_BC026486.1,GB_BC027004.1,
78+24dbEST_CX566436.1,dbEST_CV784611.1,dbEST_BU053811.1,dbEST_CX562356.1,REF_NM_001199146.1,REF_NM_153410.5,REF_NM_001199147.1,GB_AK048691.1,GB_AK084631.1,GB_AK082985.1,GB_BC071197.1,
79+4dbEST_BI734057.1,ENSMUST00000145884,ENSMUST00000114135,GB_BC027004.1,
89+28dbEST_CX566436.1,dbEST_CV784611.1,dbEST_BU053811.1,dbEST_CX562356.1,REF_NM_001199146.1,REF_NM_153410.5,REF_NM_001199147.1,GB_AK048691.1,GB_AK084631.1,GB_AK082985.1,GB_BC071197.1,GB_AK192364.1,
910+33dbEST_CX562356.1,dbEST_BI734057.1,dbEST_CA450643.1,dbEST_CA320644.1,REF_NM_001199146.1,REF_NM_153410.5,REF_NM_001199147.1,GB_AK048691.1,GB_AK084631.1,GB_AK082985.1,GB_BC071197.1,GB_BC027004.1,GB_AK192364.1,
1012+32dbEST_CX564480.1,dbEST_BI734057.1,dbEST_CA450643.1,dbEST_CA320644.1,REF_NM_001199146.1,REF_NM_153410.5,REF_NM_001199147.1,GB_AK048691.1,GB_AK084631.1,GB_AK082985.1,GB_BC071197.1,GB_BC027004.1,
1112+5dbEST_BQ942790.1,dbEST_BY136532.1,dbEST_CX210590.1,ENSMUST00000114134,
1213+34dbEST_CX564480.1,dbEST_BI734057.1,dbEST_CA317357.1,dbEST_BU707597.1,REF_NM_153410.5,REF_NM_001199147.1,GB_AK048691.1,GB_AK082985.1,GB_BC071197.1,GB_BC027004.1,GB_L23316.1,
1215+11dbEST_BQ942790.1,dbEST_CX210590.1,dbEST_BY095716.1,dbEST_BX523588.1,REF_NM_001199146.1,GB_AK084631.1,GB_AK177427.1,
1315+30dbEST_CX562704.1,dbEST_BU058911.1,dbEST_BM951513.1,dbEST_CD353596.1,REF_NM_153410.5,REF_NM_001199147.1,GB_AK048691.1,GB_AK082985.1,GB_BC071197.1,GB_BC027004.1,GB_L23316.1,
1415+4dbEST_BY003648.1,dbEST_BB610371.1,ENSMUST00000147873,GB_AK075789.1,
1516+45dbEST_CX562704.1,dbEST_BM951513.1,dbEST_CD353596.1,dbEST_BQ942790.1,REF_NM_001199146.1,REF_NM_153410.5,REF_NM_001199147.1,GB_AK048691.1,GB_AK084631.1,GB_AK082985.1,GB_BC071197.1,GB_BC027004.1,GB_AK177427.1,GB_L23316.1,GB_AK075789.1,
1617a+30dbEST_BQ942790.1,dbEST_BU703280.1,dbEST_CN698174.1,dbEST_BU505773.1,REF_NM_001199146.1,REF_NM_153410.5,REF_NM_001199147.1,GB_AK048691.1,GB_AK084631.1,GB_AK082985.1,GB_BC071197.1,GB_BC027004.1,GB_L23316.1,GB_AK075789.1,
17a17c-1dbEST_BE226010.1,