NIA Mouse Gene Index (mm92)

Exon structure for U001950

chr2 +

Exon1 76513338 - 76513691
	GAAAGCGACGTCGGGGTCAATGAAAACAAGCCGGGAAGCCCGAGGGGAAGGAAGGCAGGCGTGCAGGAGGGCAGCGCCGGGGCTCGTGGAGCGGTGGCGG
	AGCGGGAGGGCGGCGGGCGCTGGGGTCGTCCCGGGGGTCGCCGCGCCGTTCCCGCTGGGGATGTCCGCGCCTCGCGGCCTCCGAGCAGCAcggggcgccc
	gccggccgggcctctgagggccgccgggtcggggcggagggctgcgggcccgcgcctccgcagcagcgcggccggcgccgggccAGGAGGATGCGCGGCG
	CCGGGCTCTGAAGCATGGAGGGGGTTCTGTACAAGTGGACCAACTATCTCACAG
Exon2 76518220 - 76518336
	GTTGGCAGCCTCGATGGTTTGTTCTGGATAATGGAATCCTGTCCTACTATGACTCACAGGATGATGTCTGCAAAGGGAGCAAAGGGAGTATAAAGATGGC
	GGTCTGTGAGATTAAAG
Exon3 76520787 - 76520942
	TCCATCCCGCAGACAACACAAGAATGGAGTTAATCATTCCAGGAGAGCAGCATTTCTACATGAAGGCAGTAAATGCCGCCGAGAGACAGAGGTGGCTGGT
	TGCCCTTGGGAGCTCCAAAGCGTGTTTGACCGACACGAGGACTGCAAAAGAGAAAG
Exon4 76524676 - 76524812
	AAATAAGTGAGACCAGTGAATCTCTGAAAACCAAAATGTCTGAACTTCGCCTCTACTGTGACCTCCTGATGCAGCAGGTTCATACGATCCAGGAATTCGT
	CCACCGTGATGAGAGGCATCCCTCTCCCAGTGTGGAG
Exon5 76525339 - 76525503
	AACATGAATGAAGCCTCCTCCTTGCTCAGTGCCACCTGTAACACATTCATCACAACCCTGGAGGAGTGTGTGAAGATCGCCAACGCCAAGTTTAAACCTG
	AGATGTTTCAACTGCCTCATCCGGATCCCCTGGTCTCTCCCGTGTCGCCTTCTCCTGTTCAGATG
Exon6 76528502 - 76528545
	ATGAAGCGTTCAGCCAGCCACCCTGGTTCCTGCAGTTCCGAGAG
Exon7 76530706 - 76530821
	GAGCAGCTGCTCCATCAAAGAACCAGCATCTGCCCTCCACCGACTTCCTCAGCGACGCCGCAGAACCTACTCGGACACAGACTCTTGTAATGATGTTCCC
	CCTGAAGACCCAGAGA
Exon8 76533441 - 76535392
	GACCTCTTCACTGTTCAGGAAACACACTTAATGGAGATTTGGCATCAGCAACCATTCCGGAAGAAAGCAGACTCATGGCCAAGACACAATCTGAAGAACC
	TCTTCTGCCCTTCTCCTGAGGAAACAGACATGCCCAGCTTCCTCCTGAGGAAACAGACATGCCCAGCTTCCTCCTGAGGAAACAGACATGCCCAGCTTCC
	TCCTGAGGAAACAGACATGCCCAGCTTCCTCTGAGTGTCGCTATGCAAAAGCTGCTGTAATTAAACTCGGTCTGGGCTAGCTTTGCCCTCTCCTTAGGAT
	TTCTCTGCACTTTATAGAATATTGTAAACAAACAACCCACATACTTTTGAAGTGTATTTTATCTTTCTATAGTTTACTTGCAAGAGTATTTTCCTAATAA
	CTTCACAGTATGAATGTGCATCTTTTTTTTTTTTTAAACAAATGATGGTGTAACATTTTGACATCCATAAGGACAAATGTAGATATTTTTCTAAAAAACT
	GTGAGGGACTGACAGCTTGGTCAGTGTGTATTGTAGTATATAAACATGAAATCTCGCCAGATTTATTTGACAGAAATGTGAGAGATGTAACTTGTGCCAT
	GGACCAAAAGGTCACTTCACCCCAGCTTAAAATTAATTACCATAGCAGCTTGATGGTGATTATATCATATTCCTTTAAGCAAAAAGGAAACGCTTAATAT
	TCTAAAGGTCTTTAGCCCAAATACCATGACATATTGAGCATTTTTTTTTAAAAAGCAGACTCCGCTGTCCTTCATATGTGAAGTTGACATCTACTGATTT
	GTCAATACCAAACATCAGATTACAGtatttaatttttatttatttattttCTTATTGCATCAGAAGATGGTTATGTCCTAACTTTTATGGCCTCCCCAAT
	TTAAGATGTATATGCATAGTTGTTATTACGTTGTTCTAAGATACATGAGGCAAGTGTCCCAGTGATCTTGTTCCCTTACACGAGAGAAGTAAACAGCTTT
	CAATGGGAATGGAGTTCAGTGCTTTTCAGAAAATAGGCAGCAAGCTGCTGTTGTAAGGTATGATTTGCAGCTCTTTGGCATATCTAGAGACATTTTTAAT
	TTATGAATATTTATACAAAAAGCAATTCTGTCAAGATGACTGTTCTATATCACTTGAGAATGGCATTATTTAATTAAAGAACAATTTGCAGTTTTTGGTA
	GTGCCTGTTGTATCTATCGCTGGGTTACTCCTCTACACTGTATTTCTTTTAAGTCACTTTGGGGTGTTGATTTTATCCCGGAGTTAGAATGATCAGCACT
	TTAACAAAAATTGGCCTTGTGTTTTTAAGTTAGTCATATTTTACTAATACATGGTTTTTACATTCAAATTCATCATATAATACATTGTGTCTTTTACATT
	CATTGATACTCTGTCTAGTCTATTAAATACCTTTTGTGTTCTTCATGATTTTATTTTGTTTATTGTGTTCGAGCCTAAAGGTGAGCATACATCAATGTTT
	GGCTTGTCTTTTCTATGAGTTTAGAATGGGAGCCAAGTATCTAGTAAATACTTGATATTTAGTCTGTACCTTTCCCCAAGTTTAAAATGTCTATACCTAT
	TAACTGTTCCAAAGTGCTTGTCATTTTAACTAGCAAATGGCTCACTAGAGAATCCTTTGTCCAGTGGAATCAGCCCACCTGTAACTTGCGTTTCATATGT
	TCAGTTTGGAAAAAAATGATGATGTGGGCAGTCTTTTTTTTAAACCATACAAACTTGCAGAATATGGTGCTTCTGATAGTTTCTCTGGTAGTTGTTCCCC
	CTTGGTAGTAGGTTTATAATGAATATTACAAGCTTTTGAACTTGTAGGAATAGAGGAAATTCCATTTTTTATTGCTTTACCCAAATAGACATGTTTGTGA
	ATGATTTCTTTGTAAATATTTTAAAAATAAAAGGCAGTCGTTTTTAGTTTGC

Links between exon parts

From
exon
To
exon
Splice
sites
SupportExamples
12+13dbEST_CJ180967.1,dbEST_BY730332.1,dbEST_CF551102.1,dbEST_BQ918105.1,REF_NM_031256.3,GB_BC031110.1,GB_AF286163.1,
23+17dbEST_BY730332.1,dbEST_CF551102.1,dbEST_BQ918105.1,dbEST_BG961772.1,REF_NM_031256.3,GB_BC031110.1,GB_AF286163.1,
34+20dbEST_BY730332.1,dbEST_CF551102.1,dbEST_AA184412.1,dbEST_BE136879.1,REF_NM_031256.3,GB_BC031110.1,GB_AF286163.1,
45+17dbEST_BG961772.1,dbEST_BF133722.1,dbEST_CN531971.1,dbEST_DV650261.1,REF_NM_031256.3,GB_BC031110.1,GB_AF286163.1,
56+14dbEST_CN531971.1,dbEST_DV650261.1,dbEST_DV646632.1,dbEST_CF907998.1,REF_NM_031256.3,GB_BC031110.1,GB_AF286163.1,
67+17dbEST_CN531971.1,dbEST_DV650261.1,dbEST_DV646632.1,dbEST_CF907998.1,REF_NM_031256.3,GB_BC031110.1,GB_AF286163.1,
78+16dbEST_DV650261.1,dbEST_DV646632.1,dbEST_CB237890.1,dbEST_BI693263.1,REF_NM_031256.3,GB_BC031110.1,GB_AF286163.1,