NIA Mouse Gene Index (mm92)

Exon structure for U002323

chr2 +

Exon1 119568043 - 119568597
	GGGGCGCTGAGCGTCTACAGTCCCCGCCGCGCCGCGGGCTGGTGGGCTCGGCTGCGGCTCCGGTGCCGGGAGATGACCCTGCCCGGGCGCCCGACGGGCA
	TGGCGCGGCCACGGGGCGCGGGGCCCTGCAGCCCCGGGCTGGAGAGGGCTCCGCGCCGGAGCGTCGGGGAGCTGCGCCTGCTCTTCGAAGCGCGCTGCGC
	CGCAGTCGCCGCTGCAGCAGCCGCAGGGGAGCCCCGGGCCCGCGGGGCCAAGCGGCGTGGGGGACAAGTGCCCAACGGGCTCCCGCGTGCTGCCCCTGCC
	CCGGTGATCCCTCAGCTCACTGTGACAAGCGAGGAGGATGTGACCCCGGCCAGCCCAGGGCCGCCAGACCAGGAGGGGAACTGGCTCCCAGCTGCGGGGT
	CGCACCTGCAGCAGCCACGCCGCCTCTCCACCTCGTCCCTCTCCTCCACCGGCTCCTCGTCGCTGCTCGAGGACTCGGAGGACGATCTGCTGAGCGACAG
	TGAGAGCAGGAGCCGCGGCAACGTGCAGCTGGAAACCAGCGAGGACGTGGGGCAG
Exon2 119574926 - 119575022
	AAAAGCCACTGGCAGAAGATCCGTACCATGGTCAATCTGCCTGTCATGAGTCCTTTCAGAAAGCGCTACTCCTGGGTGCAGTTAGCAGGGCACACAG
Exon3 119575098 - 119575314
	GGAGTTTCAAAGCTGCCGGCACCAGTGGCCTGATCCTGAAACGCAGCTCGGAGCCTGAACACTACTGCCTGGTGCGGCTGATGGCTGACGTGCTGCGTGG
	GTGTGTGCCGGCCTTCCATGGCATAGTCGAGCGGGATGGTGAAAGCTACTTGCAGTTACAGGACCTGCTCGATGGCTTCGATGGGCCTTGTGTGCTTGAC
	TGCAAGATGGGTGTCAG
Exon4 119575409 - 119575613
	AACTTACCTGGAAGAGGAGCTGACCAAAGCCCGAGAACGACCCAAGCTGCGGAAGGACATGTATAAGAAGATGCTGGCAGTGGACCCTGAGGCACCTACT
	GAGGAGGAGCATGCGCAGCGCGCCGTCACCAAACCACGCTACATGCAATGGCGCGAAGGCATCAGCTCCAGCACTACACTCGGCTTTCGCATTGAGGGCA
	TCAAG
Exon5 119575830 - 119575931
	AAAGCCGATGGATCTTGCAGTACTGATTTCAAAACTACACGAAGCCGAGAGCAAGTGACCCGTGTCTTTGAGGAGTTCATGCAAGGAGATGCAGAAGTGC
	TG
Exon6 119576213 - 119576284
	AGGAGGTATCTGAACCGCCTACAGCAGATCCGGGATACCCTGGAGATCTCTGATTTCTTTAGACGGCACGAG
Exon7 119576400 - 119576999
	GTGATTGGCAGCTCACTCCTCTTCGTGCATGACCATTGCCATCGTGCTGGTGTGTGGCTCATCGATTTTGGCAAGACCACGCCTCTCCCCGATGGCCAGA
	TCCTGGATCATCGGAGGCCCTGGGAGGAGGGCAACCGTGAGGACGGCTATTTGCTGGGGCTGGACAATCTCATTGGCATCTTGGCCAGCCTGGCTGAGAG
	ATGAGGCTGAGCCCTTTTCCCTCAACGTGGGCCGGCTGGTCAGACAGATGTGCACCTGTGGCTGCATCCCCACCATGCATGCCGGCAAGAGACTGGAACC
	CCGCTGGGCGGGCAGTTCACATGGTCCTGCAGGACCGGGTGCCATCCACTAAGGGGGTGTAGTACATCAGGAGTTGCCTACCACACAAGCCTGTTTCCCA
	GAGCTGAATGACACTAATTTATAGGGAGGGGGAGAAACAATGGGCTTCTCCCCCAGCCCAGCTCTTCTCAAGTGGCTTTGCACCTCTCCAGAGGGTCCCG
	ATCCATAATTGTACTTCACAGGTATATAGACTTCCTGGTCTAACTCCTGCACTACAGTGGACACCCTTCCTAATAAAACTCAAAGATTCAGCTTCTGTGA

Links between exon parts

From
exon
To
exon
Splice
sites
SupportExamples
12+6dbEST_BG518844.1,dbEST_BY298133.1,dbEST_BY282462.1,ENSMUST00000028758,REF_NM_146125.2,GB_BC027291.1,
23+5dbEST_BY298133.1,dbEST_BY282462.1,ENSMUST00000028758,REF_NM_146125.2,GB_BC027291.1,
34+4dbEST_CN455603.1,ENSMUST00000028758,REF_NM_146125.2,GB_BC027291.1,
45+4dbEST_CN455603.1,ENSMUST00000028758,REF_NM_146125.2,GB_BC027291.1,
56+6dbEST_CN455603.1,dbEST_CD776256.1,dbEST_BI408812.1,ENSMUST00000028758,REF_NM_146125.2,GB_BC027291.1,
67+6dbEST_CN455603.1,dbEST_CD776256.1,dbEST_BI408812.1,ENSMUST00000028758,REF_NM_146125.2,GB_BC027291.1,