NIA Mouse Gene Index (mm92)

Exon structure for U003212

chr3 +

Exon1 51028369 - 51029209
	AGGACTGACGCTCAACGCCCTGCAGTCCGTTTCCGCCTCTCGTGCCTGAGGGGCGGATGCTTGTCGCAGCCGCCACACAAGTAGCCAGCGCGTCCTGGTG
	CCTAATCTCCTTCAGCACCGCGGAGCGTGGAGCCCACAGCTCGGGGAGGACGTTCTCCCAGACACGCGCTCGCACACACTCAGCGCTGGCACCAACCCGG
	GATTCCCAGCCTGTGGACGCTCCCATTGCAGCCGGCGGGAGGGGACAGAGGCTCCCGGAACGCCTCTCTAACGAATCCCCGCGGTGTCAGCCAGCCCCCA
	GCCTCCGCCCCGTGGGAGATCTACAGTCGCTGTCACTGATCCAGACGGTCCATTCTCGGCCGGAGCTGTCCGGGTCTGACTGCGCCCTGGTCGTGCGCGC
	GGATCCCCCCCTCTGCAGCCACCGCGTGGTAGCGCCCGCTCCGCCGCCGCTCGCCGGTTGCTCCCCGGCGCTAGCTCCCTCGCCTCAGTGAGCCGCCGCT
	GCTGCCGCCGCCGCGTCTGCCTCCCGGCACAGCTCGCCCGGTCGGCGCCGAGGGACGAGGAGGAAGGAACACCCCGCAGCGCAGCGGTCCCGCGCCACCC
	CCACCCCACCGTCGCCCGCCCAGCTCGGCCCGGCTCGTCAGCGCGGCGGCGCCCGGCATGTATCAGAGCCCGCGGCGGCTCTGCTCGGCCCTGCTGCTCA
	GGGACGCCCCCGGCCTGCGCCGCACACTCGTGCCCGGCCCGCGCCGAACGCTCGCCCCGCCGGTGCTCGGATCTCGGCCCAAGTCCCCGCAACTGCAGGC
	GGCGGCGGCCTCGGGCGCCGCGAGGTCGCGTCCCCGAACAG
Exon2 51044128 - 51044416
	tctctcttctcttgcttcgctctcttgcttttctctctctcttgctttttcgctctcttgcttctcgctctctcttgcttcttgctctcttttcctgaag
	atgtaagaataaagctttgccgcagaagattctggtctgtggtgttcttcctggccggtcgtgagaacgcgtctaataacaattggtgccgaattccggg
	acgagaaaatccgggacgagaaaaaactccggactggcgcaggagggatacttcattccagaaccagaactgcgaatcaaggttataag
Exon3a 51044496 - 51051726
	gttcccgtaaagcagactgttgagaaggattcaactgccgaattcagaactcatcagctggggaacggaagtgagaaatggctttaccaggtatgtttgg
	ccttgaactttttctagtgttaggagcccttttgttccttttcacatgttatatagtgcttaaggcagggctaaaaattctagaggaaattcaggacagt
	ctatcagaagtaaagcggagagagagagtaggaacaaggagaaacggtaagtatacaggcctttccaagggtcttgaacccgaggaaaagttaaggttag
	gtaggaatacctggagagagattagaagaaaaagaggaaaaagggagaagaaaaaagatcgattagcggaggtctctaggagatactcgtcactagatga
	gctcaggaagccagctcttagtagctctgaagcagatgaagaatcctcctctgaggaaacagactgggaggaagaagcagcccattaccagccagctaat
	cggtcaagaaaaaagccaaaagcggctggcgaaggccagtttgctaattggcctcagggcaatcggctaccaggtgcactcccgccctatgcggagtccc
	cgccctgcgtagtgcgtcagcccgtagtgcgtcagcaatgcgcagagaggcagtgcgcagactcattcattccccgagaggagcgggggaaaatacagca
	ggcatttccagtctttgaaggagccgagggtgggcgtgtccacgctccggtagaatatgtgcagattggggaacttgccgagtcggtccgtaaatatgga
	atcaatgctaattttaccttgatgcagttagacaggcttgccagcatggcactaactcctgccgactggcaaatgattgcaaaagccgctctccctagta
	tggccaaatatgtggaatggcgagctctgtggcaggaggcggcacaggcgcaggaccgagcaaacgctgctgctttaactccagagcagagagattggac
	ttttgacttgttaacgggtcagagagcttattctgctgaacctgataagaggtatcaatggaaggtcttaccacagggaatgtccaatagtcctacaatg
	tgccaactttatgtgcaagaagctcttttgccagtgaggaaacagttcccctctttaattttgctcctttacatggatgacatcctcctgtgccataaag
	accttaccatgctacaaaaggcatatccttttctacttaaaactttaagtcagtggggtttacagatagccacagaaaaggtccaaatttctgatacagg
	acaattcttgggctctgtggtgtccccagataagattgtgccccaaaaggtagaaataagaagagatcacctccataccttaaatgattttcaaaagctg
	ttgggagatattaattggctcagaccttttttaaagattccttccgctgagttaaggcctttgtttagtattttagaaggagatcctcatatctcctccc
	ctaggactcttactctagctgctaaccaggccttacaaaaagtggaaaaggccttacagaatgcacaattacaacgtattgaggattcgcagcctttcag
	tttgtgtgtctttaagacagcacaattgccaactgcagttttgtggcaaaatgggccattgttgtggatccatccaaacgtatccccagctaaaataata
	gattggtatcctgatgcaattgcacagcttgcccttaaaggtctaaaagcagcaatcacccactttgggcaaagtccatatcttttaattgtaccttata
	ccgctgcacaggttcaaaccttggcagccgcatctaatgattgggcagttttagttacctccttttcaggaaaaatagataaccattatccaaaacatcc
	aatcttacagtttgcccaaaatcaatctgttgtgtttccacaaataacagtaagaaacccacttaaaaatgggattgtggtatatactgatggatcaaaa
	actggcataggtgcctatgtggctaatggtaaagtggtatccaaacaatataatgaaaattcacctcaagtggtagaatgtttagtggtcttagaagttt
	taaaaacctttttaaaaccccttaatattgtgtcagattcctattatgtggttaatgcagtaaatcttttagaagtggctggagtgattaagccttccag
	tagagttgccaatatttttcagcaaatacaattagttttgttatctagaagatctcctgtttatattactcatgttagagcccattcaggcctacctggc
	cccatggctctgggaaatgatttggcagataaggccactaaagtggtggctgctgccctatcatccccggtagaggctgcaaaaaattttcataacaatt
	ttcatgtgacggctgaaacattacgcagtcgtttctccttgacaagaaaagaagcccgtgacattgttactcaatgtcaaagctgctgtgagttcttgcc
	agttcctcatgtgggaattaacccacgcggtattcgacctctacaggtctggcaaatggatgttacacatgtttcttcctttggaaaacttcaatatctc
	catgtgtccattgacacatgttctggcatcatgtttgcctctccgttaaccggagaaaaagcctcacatgtgattcaacattgtcttgaggcatggagtg
	cttgggggaaacccagactccttaagactgataatggaccagcttatacgtctcaaaaatttcagcagttctgccgtcagatggacgtaacccacctgac
	tggacttccatacaaccctcaaggacagggtattgttgagcgtgcgcatcgcaccctcaaagcctatcttataaaacagaagaggggaacttttgaggag
	actgtaccccgagcaccaagagtgtcggtgtctttggcactctttacactcaattttttaaatattgatgctcatggccatactgcggctgaacgtcatt
	gttcagagccagataggcccaatgagatggttaaatggaaaaatgtccttgataataaatggtatggcccggatcctatcttgataagatccaggggagc
	tatctgtgttttcccacagaatgaagacaacccattttgggtaccagaaagactcacccgaaaaatccagactgaccaagggaatactaatgtccctcgt
	cttggtgatgtccagggcgtcaataataaagagagagcagcgttgggggataatgtcgacatttccactcccaatgacggtgatgtataatgctcaagta
	ttctcctgcttttttaccactaactaggaactgggtttggccttaattcagacagccttggctctgtctggacaggtccagacaactgacaccattaaca
	ctttgtcagcctcagtgactacagtcatagatgaacaggcctcagctaatgtcaagatacagagaggtctcatgctggttaatcaactcatagatcttgt
	ccagatacaactagatgtattatgacaaataactcagcagggatgtgaacaaaagtttccgggattgtgtgttatttccattcagtatgttaaatttact
	agggcagctaatttgtcaaaaagtctttttcagtatatgttacagaattggatggctgaatttgaacagacccttcgaggcttgccatcattcaggtcaa
	ctccacgcgcttggacctgtccctgaccaaaggattacccaattggatctcctcagcattttctttctttaaaaaatgggtgggattaatattatttgga
	gatacactttgctgtggattagtgttgcttctttgattggtctgtaagcttaaggcctaaactaggagagacaaggtggttattgcccaggcgcttgcag
	gactagaacatggagcttcccctgatatatctatgcttaggcaataggtcgctggccactcagctcttatatctcacgaggctagtctcattgcacgaga
	tagagtgagtgtgcttcagcagcccgagagagttgcaaggctaagcactgcaatggaaaggctctgcggcatatatgagcctattctagggagacatgtc
	atctttcatgaaggttcagtgtcctagttcccttcccccaggcaaaacgacacgggagcaggtcagggttgctctgggtaaaagcctgtaagcctaagag
	ctaatcctgtacatggctcctttacctacacactggggatttgacctctatctccactctcattaatatgggtggcctatttgctcttattaaaagaaaa
	agggggagatgttgggagccgcccccacattcgccgttacaagatggcgctgacatcctgtgttctaagtggtaaacaaataatctgcgcatgtgccaag
	ggtatcttatgactacttgtgctctgccttccccgtgacgtcaactcggccgatgggctgcagccaatcaaggagtgacacgtccgaggcgaaggagaat
	gctccttaagagggacggggtttcgttctctctctctcttgtctctctctctcttctcttgcttcgctctcttgcttttctctctctcttgctttttcgc
	tctcttgcttctcgctctctcttgcttcttgctctcttttcctgaagatgtaagaataaagctttgccgcagaagattctggtctgtggtgttcttcctg
	gccggtcgtgagaacgcgtctaataacaCTACTGTCCGTATTGCCCTACAATGTAGTAGGGTTTCTCttttgtttttgagacagcgtctcactgtgttac
	cctggctggtctggaaagaattgatgtataccagactagcaaactcagaaacctgcctgccactgccgcctaagtgctgggattaaTTGGACAATCAACT
	CTGAGTTCTcttttgcacttgctctccctctgtccagactgcccttcagtagatctgttgggctgattttccagcctcccgtatctttgaagacccatcc
	tggaccatcacagataagcaagcgatttctctgctacccagattcctacctcacctctcctgtttttctccattaaagttttcgccaaatgtacactctg
	gccctttggtcttcccactacaagatatgctgcctgggaacaagggattggtctgtttggtcaccagtgtgtctacaggaggctagggtagtgtctgaca
	cacagtgggcattgaaACAGTGAGATGTTGATGTGCAAATGTGGGCTGTGCTTGTATGGGTGAGGCAGGGGTTGATGGAGATTACTGTGATGGACTCAGT
	AAGTGGTGTGTATTCACAATGAGTGTTGTATCTCTAAGTACCTCTTCAAGTTTATTttttgttttattttttgagatggggtctcactacatagctctgg
	ctgcctggaacttgccgtgtagaccaggctgacctggaactaacagatctgcctgccactacctcaagcactggggttaaagttttgagtgttcaaccat
	gccagccttttaaaagacttttctggttattTTTGGCACTTTGAGGCTAGGTCCCAGGTAACTCAGCCTCTCATTCACCTTGTATGCTAGTATGTGATAT
	GCTGGCTTTCAGGAGAAATGTCGAGAAACTAACTGTGATGACTAAGGGACAGTTAGGAGTTGTTTTTAACATTTGTTATATGTGTTTTCtgtgtatgtgt
	gcatgcatgggagacagaacacagttcctgggagtcagtcctcttctatcgtgtggattctgaggatcagactcgggttgtcagactagagatgagagca
	ggagctcttcccactgggccatcctgccagcttcTGCTTTTAGGATAGAGTGTTCCCTTCACTCTGCCCTCCTTTGTGTTGTGTTTTTTATGTATTCCTT
	GTTGAGCAGTTAGCTTTTGTATAAATAATTTTTTCTTTAGACTTGAATATCTAGGTGGGGAGGACCAATTTGAATTAAGGAAAATTAACAAAAAGAAGAT
	ACCTGGgccgggcatggtggcgcacgcttttaatcccagcactcgggaggcaggggcaggcggatttctgagttcgaggacagccagggctacacagaga
	aaccctgtctcgaaaaaccaaaaaaaaacaaaaaaacaaaaaaacaaaaaCAAAAGAGGATACACCTGACTACACCAATTGATTTTGATACTCAGGGACA
	ACTGTGACCAGCCAGGGTCACTAATTTGAACCAACTGCTTGTTATTAGCCAGCCCAATTTTTTTTTTAATAAAGATAACTTGGTCTTTGTCTCTCAAGAG
	ACAGTAAGTTgggaccggagagatggcttaatgaataagaatgcatacttaccgaagccccagttcagttcacagcagttgtgttggacagctcacaaac
	tacctggaactgtagctccaggggagtccagacccttttctggcctcccctcagttacctgcacacactggtacactcacaActggaaattggactcagg
	acctctggaagagcagccagtgctcttacccgctgagccatctctccagcctcACCCTGTACTTTTTTAATGAGAATATGTTCAATGCTGATCACAGGAT
	TCTCCAAGAAGCCCCATCCCTGATTGGACGTCTGAAAATGAGAGAAGCGAAGGTTAAACCCACCACTACCGGGGAGGGGGTGGTCCCCTCAGACAGCACA
	GCTAGGACCTCGGCTTTCTACGTTCACCCTTCAAAACCCATTGGAGTGTTTGGTTCTGTTGttggtttgttgagacagggtttctctgtgtagccttgac
	tgtcctgaaacgccctctgtagcccaggctggcatagaactcatagagatctgcctgccttcctttccctctgtgggattaaaggtgtgcagcgtgcacc
	accactgccgggcACAAAATCCAATTCTTTAAGATACAAACTTGGGAGAAGGCTGTGTCTTTGGTTAAAGGATGCTTGTATAAGACTGGGCGGGTGTGTC
	AACACAAGAGGCTATTGAGGTTACAAGCATAAGCTTAGTTTCGCGAGAGATTAGTTAGCAGCAATACTTAAATTACCTGCCCGTGTAAGACGCTGGAGGC
	CAGAAGCTCCCATCACCCACCCACCCCTAGAGATGGCGTGATGCCCACAGGCAGTGGGGCCCTGGCTCATACCGGAGAGGGACAGTGAAGGCCCTGACTG
	ACAGCTGGCTATGGGACTGTTTCTCCTGCAG
Exon3b 51051727 - 51051996
	TGAGTTCCATGGGAAACGGCACCAGTCGACTCTACAGTGCTCTCGCCAAGACCGTCAACAGCAGTGCAGCTGCTCAGCACCCGGAGTACTTGGTGTCAAC
	TGACCCCGAACATCTGGAGCCCATCGATCCTAAGGAACTTCTGGAGGAATGCAGGGCTGTTCTGCACACTCGGCCACCCCGCTACCAGCGGGATTTTGTG
	GACCTGAGGACAGATTGCTCCAGCAGCCACTCTCCCATTCGCGTCATGCAGTGGAACATCCTCGCCCAAG
Exon4a 51053619 - 51055480
	CTCTCGGAGAAGGCAAAGACAACTTTGTGCAGTGCCCCGTGGAAGCGCTCAAATGGGAAGAGAGGAAGTGCCTGATCCTGGAGGAGATCCTGGCTTACCA
	GCCAGACATACTGTGCCTCCAGGAAGTGGACCACTACTTTGACACCTTCCAGCCACTCCTCAGTAGACTGGGCTACCAAGGCACGTTTTTCCCCAAGCCC
	TGGTCACCATGTCTAGATGTGGAACACAACAACGGTCCAGATGGCTGTGCCTTATTTTTTCTCCAAAACCGATTCAAGCTTATCAGCAGCACCAATATTA
	GGCTGACAGCCATGACCCTAAAAACCAATCAGGTGGCCATCGCACAGACCCTGGAGTGCAAGGAGTCTGGGCGACAGTTCTGCATTGCTGTCACCCACTT
	AAAAGCCCGCACTGGCTGGGAGCGGTTCCGGTCAGCTCAGGGCTGTGACCTCCTCCAGAACCTGCAGAACATCACCCAGGGAGCAAAGATCCCCCTGATC
	GTCTGCGGGGACTTCAACGCAGAGCCAACCGAAGAGGTCTACAAACACTTTGCGTCCTCCAGCCTCAACCTCAACAGCGCCTACAAGCTGCTGAGTCCCG
	ATGGACAGTCGGAGCCTCCCTACACAACCTGGAAGATCCGGACCTCAGGCGAGTGTCGCCACACGCTGGACTATATCTGGTACTCCAGACATGCTCTGAG
	TGTCACGTCCGCCCTGGATCTACTCACTGAAGAACAGATTGGGCCCAACCGGCTCCCATCCTTCCATTACCCCTCGGACCACCTGTCCCTGGTGTGTGAC
	TTCAGCTTTAACGAGGAGCCCCATGAGCTCTTTTAATCACAAGCGTCTTAACCAGGGATGTTTTGGGAAACTGAACTAGGATAGGAAGTTGCCTGGAAAA
	GGACACCCAGTTTCTGCCACTACTCTCCATCATTTCCAGCATGCCCTTGAAAAAACATTGTTCACAAACCTTTCCAGCTAAAACCCGCATTGAAAAGGTG
	TTTGCACTCCAGTTTGAGCTTGTTGTTCATCTGTGTACCATCCTCTACCATTTAGGGGCATTAGTAGCATAGGCTTTCTTGTTTTTTAGTTGAGGGTATT
	ATAAAAACCCAGTTTGTAAGCCCTTCAGAATTAAAGTAAGATGTAGGAAGTTTTCTAGACATCATTTCAAGTTATTTATTTGTGGGATTTTTAAATGTCA
	GTGGGAAAAAAAATGCATGGtaatatttatttttttatatcttaatgtaaaataaaGTGGATTATCTAGCATTGTGGACATTTTAGAACCATGCAGGTAC
	AGTCTTAATTCCTTAAAAATTAAAATGTCTCTATTTGCTGATCGAACAGGATGTACACTAAGGAACTATTTAGCCCTGGGGGATTGGTGACTTTGTGTGT
	ACATTCTTCACAAATAATTCCTGTTTGCTATGCCTTTGACTTCTCTGTTGTGTTTTAAAGAAATTCCGTAGCATTCAGTTCTTTAGTTTCCACTGTTTAG
	TCACTGCTAGGCACTTGTGCCTTTTCTGTTGTGATGACGTTGGTAGACGTGTGAAGATTACTCCAATCACTTCTCCTGGGATGTGCTTTTTATAAGTAGC
	TTTAGGAACAGCTCTGGAACAGTTGCTAAGAATATTAGTGAGAAACCTTGCCAAGACGACAGACATGAGcccaacattcagctgagacaagaaagctcac
	gtcttggaggccagcttgggctatatgtcaagaccctttcttgaaaaagcCAGATGACTGGATTCAAGTTTTCTAGAAAAATATAAGAGTCAAAAAGATA
	ACCTGGAGTTCTCTTTCAATTGTTGAAGCCTCTTCCAAACAAAATATCCTTCCAGTGGTAAA
Exon4b 51055481 - 51055576
	ATGGTAAATATCTTAATGTATGAGTTCTAAATATTACTTAAGGTTAATAAATGGACTTACAAAGAGTGCTTTTAATATCTTGTCTCTTTGGTCTAA

Links between exon parts

From
exon
To
exon
Splice
sites
SupportExamples
13b+21dbEST_BE573380.1,dbEST_BB658807.1,dbEST_BQ919821.1,dbEST_CF583959.1,REF_NM_009834.2,GB_AK087790.1,GB_AF183960.1,GB_AK149340.1,GB_BC139369.1,GB_BC139370.1,GB_AK084516.1,GB_AK041713.1,GB_AF199491.1,
23a+1GB_U70139.1,
3b4a+64dbEST_BQ919821.1,dbEST_CF583959.1,dbEST_BF538426.1,dbEST_BI151955.1,REF_NM_009834.2,GB_AK087790.1,GB_AF183960.1,GB_AK149340.1,GB_BC139369.1,GB_BC139370.1,GB_AK084516.1,GB_AK041713.1,GB_AF199491.1,GB_U70139.1,GB_AK147356.1,GB_AK147433.1,
4a1-1ENSMUST00000167780,