NIA Mouse Gene Index (mm92)

Exon structure for U003222

chr3 +

Exon1a 52072259 - 52073259
	AggggcggggcggcgcgcgcgccgccgcgggcggggAGCCCGCTGCAGATCCCGTAAGACGGGAGTCTGCGGAGTCGCTTCAGTCCCCGCCGCCGCCACA
	TTCAACAGGCAGCAGCGCCGCTGTCGCGCGGCCGCGGAGAGCTAGAGCGGCCCGCAGCGTCCGCCCGTCTGCCTTGGCGTCCGCGGCCCTTGTCAGCGGG
	AGCGCGGTGCCCGAGCTGCCGGGCTCCGCGGCCTGGTCGGTGCCCCGTCCTAGGCACGAACTCGGAGGCTCCTTAGACACCGGTGACCCAGCGAAGTTAA
	GTTCTGGGCGCGTCCGTCCGCTGCGCCCCGCCGCGCCTGACTCCGGCGTGCGTCCGCCGTCCGCGGCCCCCCAATCTCGGAGCGACACTCGGGTCGCCCG
	CTCCGCGCCCCCGGTGGCCGCGTCTCCCGGTACTTCTCTGCTGGTGGGGGAGGGGCGGGGGCACCATGGCCGAAGCGCCCCAGGTGGTGGAGACCGACCC
	GGACTTCGAGCCGCTGCCCCGGCAGCGCTCCTGTACCTGGCCGCTGCCCAGGCCGGAGTTTAACCAGTCCAACTCGACCACCTCCAGTCCGGCGCCGTCG
	GGCGGCGCGGCCGCCAACCCCGACGCCGCGGCGAGCCTGGCCTCGGCGTCCGCTGTCAGCACCGACTTTATGAGCAACCTGAGCCTGCTGGAGGAGAGTG
	AGGACTTCGCGCGGGCGCCAGGCTGCGTGGCCGTGGCGGCGGCGGCTGCGGCCAGCAGGGGCCTGTGCGGGGACTTCCAGGGCCCCGAGGCGGGCTGCGT
	GCACCCAGcgccgccacagcccccaccgaccgggccgctgtcgcagcccccacccgtgcctccctccgctgccgccgccgcGGGGCCACTCGCGGGACAG
	CCGCGCAAGACCAGCTCGTCGCGCCGCAACGCGTGGGGCAACCTGTCGTACGCCGACCTCATCACCAAGGCCATCGAGAGCTCAGCCGAGAAGAGGCTCA
	C
Exon1b 52073260 - 52073344
	CCTGTCGCAGATCTACGAGTGGATGGTGAAGAGCGTGCCCTACTTCAAGGATAAGGGCGACAGCAACAGCTCGGCGGGCTGGAAG
Exon2 52148961 - 52150312
	AATTCAATTCGCCACAATCTGTCCCTTCACAGCAAGTTTATTCGAGTGCAGAATGAAGGAACTGGAAAGAGTTCTTGGTGGATGCTCAATCCAGAGGGAG
	GCAAGAGCGGAAAATCACCCCGGAGAAGAGCTGCGTCCATGGACAACAACAGTAAATTTGCTAAGAGCCGAGGGCGGGCTGCTAAGAAAAAAGCATCTCT
	CCAGTCTGGGCAAGAGGGTCCTGGAGACAGCCCTGGGTCTCAGTTTTCTAAGTGGCCTGCGAGTCCTGGGTCCCACAGCAACGATGACTTTGATAACTGG
	AGTACATTTCGTCCTCGAACCAGCTCAAATGCTAGTACCATCAGTGGGAGACTTTCTCCCATCATGACAGAGCAGGATGACCTGGGAGATGGGGACGTGC
	ATTCCCTGGTGTATCCACCCTCTGCTGCCAAGATGGCGTCTACGCTGCCCAGTCTGTCTGAAATCAGCAATCCAGAAAACATGGAGAACCTTCTGGATAA
	TCTCAACCTTCTCTCGTCCCCAACATCTTTAACTGTGTCCACCCAGTCCTCGCCTGGCAGCATGATGCAGCAGACACCATGCTATTCGTTTGCACCGCCA
	AACACCAGTCTAAATTCACCCAGTCCAAACTACTCAAAGTACACATACGGCCAATCCAGCATGAGCCCTTTGCCCCAGATGCCTATGCAGACACTTCAGG
	ACAGCAAATCAAGTTACGGAGGATTGAACCAGTATAACTGTGCCCCAGGACTCTTGAAAGAGTTGTTGACTTCTGACTCTCCTCCCCACAATGACATTAT
	GTCACCGGTTGATCCCGGAGTGGCCCAACCCAACAGTCGGGTCCTGGGCCAAAATGTAATGATGGGCCCTAATTCGGTCATGCCAGCGTATGGCAGCCAG
	GCATCTCATAACAAAATGATGAACCCCAGCTCCCACACCCACCCTGGACATGCACAGCAAACGGCTTCGGTCAACGGCCGTACCCTGCCCCATGTGGTGA
	ACACCATGCCTCACACATCTGCCATGAACCGCTTGACCCCCGTGAAGACACCTTTACAAGTGCCTCTGTCCCACCCCATGCAGATGAGTGCCCTGGGCAG
	CTACTCCTCGGTGAGCAGCTGCAATGGCTATGGTAGGATGGGTGTCCTCCACCAGGAGAAGCTCCCAAGTGACTTGGATGGCATGTTTATTGAGCGCTTG
	GACTGTGACATGGAGTCCATCATTCGGAATGACCTCATGGATGGAGATACCTTGGATTTTAACTTTGATAATGTGTTGCCCAACCAAAGCTTCCCACACA
	GTGTCAAGACTACAACACACAGCTGGGTGTCAGGCTAAGAGTTAGTGAGCAG
Exon3 52150918 - 52157143
	GCTACATTTAAAAGTCCTTCAGATTGTCTGACAGCAGGAACTGAGGAGCAGTCCAAAGATGCCCTTCACCCCTCCTTATAGTTTTCAAGATTTaaaaaaa
	aaaaaaaaaaaaaaaaaaGTCCTTTCTCCTTTCCTCAGACTTGGCAACAGCGGCAGCACTTTCCTGTGCAGGATGTTTGCCCAGCGTCCGCAGGTTTTGT
	GCTCCTGTAGATAAGGACTGTGCCATTGGGAATCATTACAATGAAGTGCCAAACTCACTACACCATGTAATTGCAGAAAAGACTTTCAGATCCTGGAGTG
	CTTTCAAGTTTTGTATATATGCAGTAGATACAGAATTGTATTTGTGTGTGTGTTTTTTAATACCTACTTGGTCCAAGGAAAGTTTATACTCTTTTGTAAT
	ACTGTGATGGTCTCAAGTCTTGATAAACTTTGCTTTGTACTACCTGTGTTCTGCTACAGTGAGAAGTCATGAACTAAGATCTCTGTCCTGCACCTCGGCT
	GAATGACTGAACCTGGTCATTTGCCACAGAACCCATGAGAGCCAAGTAGCCAGTGATCAATGTGCTGAATTAATGGACTTGTCAAACTTTGGGGCAGAAT
	AAGATTAAGTGCCAGCTTTGTACAGGTCTTTTTCTATTGTTTTTGTTGTTGTTTATTTTGTTATTTGCAAATTTGTACAAACAACTTAAAATGGTTCTAA
	TTTCCAGATAAATGACTTTTGATGTTATTGTTAGGACTCAACATCTTTTGGAATAGATACCGAAGTGTAATGTTTTCTTAAAACTAGAGTCTACTTTGTT
	ACATTGTCTGCTTATAAATTTGTGAAATCAGAGGTATTTGGGGGCTGCATTCATAATTTTCATTTTGTATTTCTAACTGGATTAGTACTAATTTTATATG
	TGCTCAGCTGGTTTGTACACTTTGCGATGATACCTGATAATGTTTCTGACTAATCGTAAACCATTGTAATTAGTACTTGCACACTCAACGTTCCTGGCCC
	TTTGGGCAGGAAAGTTATGTATAGTTACAGACACTCTGTTTTGTGTGTAGATTTATGTGTGTATTTTAAAGAAATTTCACCTGCTTTTATTACCCTGTGA
	GTTGTGTACAGCGCATAGCACCAAGTCTTCAGATAGATGCCACGTGCTTACAGCCTTCTAGGGAAGCCTGCCAGATGATGCCCTGTGTCACGCTGTCATA
	GTTCCCATGGGAACTCTGTCTGTCGCTCAGGAAAGGGGAACTTTTATCTAAGGTGATGTTCTTTGTCTGACTGGGGTTCGCCTCCTACTACTCTGAGCTG
	TTGGCTTTTGTCACGATGGAGGTGGCTTTGTGGCTCTGTCCTGAAGAATCCTGTCACTTCTCGGTCCCCACCTCTGTTCTCTTTGGCTCTGAACAGTGTA
	AATCTAAGGAGGAAGTTTACAAATAGGACTTCAGTGATTTATGGAGTGCTCTGTGCGCCTAAGTACAGACAGTGGCAGGATTAGTTAAAAATGAAGGCAG
	TAAACTTGGAAACCAGCCAGCTATAAATGGACATTTATTTTGAAATCCTTAGCTTAAGAATTTGAGAAGTTTTTTCAGCCTTGAGCAGCCTAATGTGTCT
	CAAACATTTACGTTTTTTATACATTCTATTTACCTGAAATCCTGCCAGACCAGGATAATTGGTTTTACCTCTCATTCCGTCCATCGGTGTTTCCCAGTCT
	CCCACAGTTTGAGGAATAGATGTACCCCAGCACCCCTCTTTGCCTTTATGAGAAGGCCTGGTTTGCATGAGAAGACCAAATTGCACTTCCATGAGAAGAC
	CAAATTGTTTGTAGTGTTACTTAGCTCTCCCCTCGTTTGTTAGTGTGTGTTAACAAGAATAAAATGTCCCTGCTTTCACCCACCGTTGGCCAGCTTTGTC
	ATAGGCTTCCCACCATAACTTTCACTATTTTAAACACATATTGAGCCACTGCTCGTCTGACTACCTTTGTTTGGGCACTCCAAAACAGGACTTGTTTTAG
	AAATGAACTCCTCCAAGTAGAGCCTCCTTCAAACAGAGTAGAATTTCCTGGTGTCAAAGAACCCGGGTCTGTCTCCCTTTCCTCCTCCCTCTGCCATTTC
	TTACCATTGCGGAAAGAGAGAGCCTCCGTGTGTAATCATTCAGTAGAGGCAGCTACCGCCCTGGCAGTGGTCTACCTGCTGAATGCCACTGAATGACTAG
	GAGGTGTCTCTCCCTTCAGAAGCTGTCAATTTCAGCAGCAACCCCTGTTTTCCTTGGTGTTAAGATCCCAGTGTGAATCATGGGCAGTTGTCTGGGGCAC
	AGTGAACTCCAGGAAAGGCTTCGTATCTGTTTTGAAAACAAACATCAAACGTGTGAGCTCCGAGGGTCCTTTTCTGGGAGAATGTTCGCTTTCTGGTCTA
	TTATTGTACATGATTGCTCTGTGAAAAGACTTCATCTATGCAGCCTTGTTTGATTCATTTCCTTTGGTGTGTTCTGTTGTTAAGAGCAAATTGTATTATA
	GAGCTATTTGGATATTTTAAATATAAAGATGTATTGTTTCCATAATATAGATGTATGGAGTATATTTAGGTGATAGATGTACAACTTGGAAAGTTCTGCT
	TGGACAAACTGAGTCTAAGTTAATTAGCAAATAATATATCCTGATGAGCAGGAAGCCCTGAAACCTAACAACAGTAAGCGGAGAAAATCACTTAAAATGG
	AAACAGTTCCCCAAAGGTGTTCAATTTGAACTTGTTCAACTGCTTAATATATGGTCCCCCCCCCCCCCAAAAAAAAAACCTTGAAGTTCTTAGTTTTCAG
	CTCTCCAAGTTACTGATTTTAAGTGAAGTTTCTCTGTGGTTTCAGCTGGGGAGTGATTGTTCAGTAGAGTGTGCATTGTGCTTTATGCAAACCAAACAGC
	CTGGCCCTGTGGCCGGGGACAGACAGACAGCCCGTCAGGATAGAGTCCCGCCCTTCGCCACCACAGCGGACTTGAGTAACAGTGCAGATGCCTTGCTCCT
	GTTCCATTGCTATCTGAGAAGTGCCTGATGAGGATGGTAAACTTACAGACACAAGAACAATCCTTACTGTGCGTTGTATAAAGCCATAAATGTACATAAA
	TCATCTTAAGTGGCTTGGTGTGTGTCTTTCCTAGTGTTCAAAGGTTCCTGAGCGAGCATGTTTTTATTCAGTCATCAAGCACTTGAGTTAGACCGTCAAC
	CCCAGTGTTAATGGCGTATGACCAAACCATGGCCCCTGATGTGAAGAAGTGCAATCTAAACTTAGCAAACCGTCTAGAGAGcaatggttctcagtgtgtg
	aggaatgaccccttgaggggttatcaaatgacccattcacagagattgcatatcacatatcctgacaatcatagcattacgattcataacagcaaaattg
	cagttatgaattaacaacaaaaacagttttgttaaatggttaggggtcaacctgacaaactacatttaagggtctcagcattaggaaagttgagaaccac
	tgGCCTAGagtctggcatggtgtcatatggctttattcctaacacttggtagtcagagataagtgggtctctcagagttagaggccagcctgatctatat
	ggtgtgtttcaggatagccaggacttcatagACCTTAAATAGTCTAGACTTTTTTATTCTTGGAATATCTGGAACCCCATTTAGGCCAGTAATTATAAGC
	ATGAAACCTTGCTTAATACCAGACTGAAGGCAAACTAGGGCGAGACAAAAGCGGGGTCATGGTTAGTGTAAACACAAGGAGATGTGGCCGACAGGGTGGC
	TTTCCCAGGCCAAATGATCCCAAGTATACATTTTGTTCAGAGAGGATCTCTGGCTGCAGCGCAGAGGGGTGGCAGTGTGTTTGCTCTTGCCAAAAGCTGC
	CGGAGAAACGAGGATTCTGTTAATAGTTCTGACTGCTTTAAAAGAAGGTTCTGCTCTTTTCCCTCTACCAGACAAGCAGACGAGTTAATATAACAGAGAA
	ATGGGGAATTCTAGGGATTTATTGTTTAGATAGCGAAAGGTCAGTCAGCTTGGGGTGTGTTCCTCTGCCTCCCCCGCTACCCACCGCAGTCTCTTCTAAC
	AGAACCTGTTCTTTGAAAATGTAGTACCCAAAGGCCAATATATATAACCCAAAATCAAAAGACAAGCTAAACCCTGAGGCTCGTGCACATAGTTGTGAAA
	CGTTTGGTGGGGTCCAAATGTGGAACTCCCTGATTGGTTTATACTAATGGAGCTCAGAAACCTGCCGGCTCCACTTCCTGAGCAGTCCTGAATTGATGAA
	TGGCTGAAGACTTAAGAAGATTTTCAACAGCGTTTGGGCTCTGCTGTGGACTAGAGATGACCATAGTCTGTCTATACATGTATACTTAGGGTAACTTTAG
	GACCAGCTTATTCTACAGTCTTTGTCTTGGATGCTGTTTCTCTATAGGCTGAAACGACCTCACAGTGGTGGAACTAGTTCCTCTGACAGTGGTTGTATGG
	TTGAGTTCCATAGGAGGGCTGACCCCAAGAGCTGTACTAAGAACAAGTCTCTGAAGCACATCCTGCCAGACACAGTAAACCTTACATCATTTAAAAGTGC
	TCAGGACAGGCTTCTGGGCCTATAACTGGGATGCAGTGACATTGTAGGAGGGTTGCGTGCACTAAAGTCATCATGTAAGGGTAATGACAACTGCAGCCTC
	TGGCCAGTGGTTTCTGTTCTCCCCTTGAATAACGAAACATTAGAAACAACCACCTAAACTAGAGCAAAGGGCTTTGATGACGATGTGCATACACAGGCTT
	AAGGTGCTTTCAAGTCCACTGACTTGGAAATGGCTGAAGAAGGAAAGAGGGAGGAGGTAATTGGGAAACGAGGCATTACAGGGAGCCACCAAAAGAAAAG
	CTGTAAGCCCAAGGATCCCTTGAGCCCACAGTATTGTGCATCTAGAAGTTCGTGGAGGTGGCTCTTACTGTGTGACCGGGCTGCACTTGGGCCTCCTGAC
	CGCTGAGCTCACAGGCGTGTGTCCCCCCGTCTGGTGAGCTTTCTTTCAGAGAGTGTCTATGTTGGTACCTGAGGAAGTTCACACTGAGAAGACATTCAAA
	TCGCCCCCAAATATTCCTCATAAACTCCTGCCAGAGAACAGTGTCAAGCCATTAACAAGTTCACATGCCCCATCAATAATGTACTGGACGCTGCCAACTG
	AAGGAGTAGATTCTCGGCCTCCGGGAAGAAAGAGCAACTTTGCAAAAGGCTTCTTAACTCCTGGTAtttgagagacatgtaacatagcacaggctagctt
	agaagccattattcttcttcagcatcctgagtgatggggttacaggtgtgccctgctatacATCCATCACTCACTCTTTACATATTTCACAAGCTCCTCT
	CTTTAGTCAGCAGCTTTCTGAATCCTCTCAGAAGTGTATAAAGTTACTCCAAAATTTCGTTGCTGAAATAAAGTGACAAGACTTTGGCTCAACAGTTTGA
	GGACATTCCTCTCATCCCAGACTGGCAAGGCGAGTCTGGTGGGTAAGAATGGCTGATGGTGCTGGCATTCCTCTCTTCCCCTTGCTCCTGAGATGGCTCT
	GTCCAGGGCAGTCCTCTTCCTGCTACTCTAACGGGTCTCAGGGACACAGCCAGAGAGGTTTGCCTCACTGTGCTTAATTGATTGGAACTTCCCCCTGGCC
	CTGTTCTTGCCAGGCAAGAAGAGCTCTATACTAAATTATATTCAAGCCTATCTGAAGAGCTTGGAAATGCAGTCACATTGATGGAGACTTACCATCACTG
	TGTAAATACATCTATGCCGTACTGGCCTCTAAGAATTGCTGGAGTTTCAGGATTCTTGTTAATTTACTGACATTTCTGCCTAAATGAGTAGACCTTAGAT
	GAACCATTAGAGTACATATTTTACTGAACCTTTTTTTTTTTTTTTTTACTTTCttttgtctttttcgagacagggtttctctgtgtagccctgactgtcc
	tggaactcactttgtggaccaggctggccttgaactcagaaatctgcctgcctctgcctcccaggttctgggattaaaggcgtgcgccaccaccacccag
	ctTACTGAACCATTTCAAACTGGTTTTCTAACTGATGAATTGAGACAGGAGCCTATTTGCACTTCAGTCCTTGATGTCAGATATGCCATGGGAACCTGCT
	ACTCTGGAAACAGTTGGAGCCTCTGC

Links between exon parts

From
exon
To
exon
Splice
sites
SupportExamples
1a1b-2dbEST_BY751999.1,ENSMUST00000174738,
1b2+22dbEST_AW121569.1,dbEST_BE985409.1,dbEST_BE949307.1,dbEST_BF018176.1,REF_NM_019739.3,GB_AK154041.1,GB_AJ252157.1,GB_AK137629.1,GB_AF114258.1,GB_BC152908.1,GB_AF126056.1,
23+84dbEST_AU022805.1,dbEST_BI415030.1,dbEST_CO802905.1,dbEST_BY763137.1,REF_NM_019739.3,GB_AK154041.1,GB_AJ252157.1,GB_AK137629.1,GB_AF114258.1,GB_AF126056.1,GB_AK053633.1,GB_AK039265.1,GB_AK212278.1,GB_AK192846.1,GB_AK211466.1,GB_AK212379.1,GB_AK043583.1,