NIA Mouse Gene Index (mm92)

Exon structure for U003655

chr3 +

Exon1 102862152 - 102862363
	TGGACTGGGTGCGGCCGGCTGCAAGACTCTAGTCGTCGGCCCACGTGGCTGGGGCGGGGACTGGGGCGCCTTGGGCGCCTAGTGATTACGTAGCGGGTGG
	GGCCGGAAGTGCCGCTCCCTGGCGGGGGCTGTTCATGGCGGTTTCGGGGTCTCCAACAGCTTCTCAGGTTGAAGTCCAAAAGCCTCCCGAGGCGGGGTCT
	GCGGAGTTTGAG
Exon2a 102862517 - 102862518
	GG
Exon2b 102862519 - 102862552
	GAAGTGGTTGTGCCAGGCGGACCCCAGAGCTTGG
Exon2c 102862553 - 102862753
	GTTTGCAGGAATTGGAAGAGGGGGGTTCTTTTCCCGTAAACTGAGGGCGGGGCCGAGTAGATTGAAAAAATAGTCGCTGGTCTTTAATCCAATAATCTGG
	CCCGCACTCATCTGCAAGGAATGCTATGTTTCTGAATCACTTTGAGAACTTAGTGGAAGGCCACGTGTATCGAATGGGTGCCTTAGAAACAGAAGAGTTT
	G
Exon3 102862828 - 102862955
	GTTTTTGCTGGTGTGAAATGACTGAGTACAAACTGGTGGTGGTTGGAGCAGGTGGTGTTGGGAAAAGCGCCTTGACGATCCAGCTAATCCAGAACCACTT
	TGTGGATGAATATGATCCCACCATAGAG
Exon4 102863862 - 102863963
	ggtctcactgcactaccctggctggcctgagacttgaactcacagatataaattcacctgcccttatgtcatgtgtgcATGCATGCGTGTGATTATGTAT
	GT
Exon5 102864124 - 102864302
	GATTCTTACCGAAAGCAAGTGGTGATTGATGGTGAGACCTGCCTGCTGGACATACTGGACACAGCTGGACAAGAGGAGTACAGTGCCATGAGAGACCAGT
	ACATGAGGACAGGCGAAGGGTTCCTCTGTGTATTTGCCATCAATAATAGCAAATCATTTGCAGATATTAACCTCTACAG
Exon6 102866297 - 102866456
	GGAGCAAATTAAGCGTGTGAAAGATTCTGATGATGTCCCCATGGTGCTGGTAGGCAACAAGTGTGACTTGCCAACAAGGACAGTTGACACAAAGCAAGCC
	CACGAACTGGCCAAGAGTTACGGAATTCCATTCATTGAGACCTCAGCCAAGACCCGACAG
Exon7 102867253 - 102867376
	GGTGTGGAGGATGCCTTTTACACACTGGTAAGGGAGATACGCCAGTACCGAATGAAAAAGCTCAACAGCAGTGACGATGGCACTCAAGGTTGTATGGGGC
	TGCCCTGTGTGCTGATGTAGTAAG
Exon8 102868039 - 102868080
	ACACTTTGAAAGTTCTGTCATCAGAAAAGAGCCACTTTGAAG
Exon9 102868157 - 102868483
	CTGCACTGATGCCCTGGTTCTGACATCCCTGGAGGAGACCTGTTCCTGCTGCTCTCTGCATCTCAGAGAAGCTCCTGCTTCCTGCTTCCCCGACTCAGTT
	ACTGAGCACAGCCATCTAACCTGAGACCTCTTCAGAATAACTACCTCCTCACTCGGCTGTCTGACCAGAGAAATAGACCTGTCTCTCCCGGTCGTTCTCT
	GCCCTGGGTTCCCCTAGAAACAGACACAGCCTCCAGCTGGCTTTGTCCTCTGAAAAGCAGTTTACATTGATGCAGAGAACCAAACTAGACATGCCATTCT
	GTTGACAACAGTTTCTTATACTCTAAG
Exon10 102869442 - 102869528
	acttttgcctgatgcctgctgttagtgctacaaggATAAAGCTTGTGTGGTTCTCACCAGGACTGGAAGTACCTGGTGAGCTCTGGG
Exon11a 102871226 - 102871829
	AACGTGTGAGCTTGGTTTTATCTTCCTTTGTATTTAGTCATAACCTCTCAAGCTGGCAGCTCCGACCAAGGATCAGAAGCTGTGTGCGTTCCACCTGGTG
	GAATTAGCTCAGCTCTATATGAGAAGTGGAGTTAATGGAAAACGTGTTGACTGGGTGGTTTCTATTTAAAAGAGTGATGATAATTCTTGAACAGTAGTTT
	TTATTTTGCTATTTCTTTAAGCTGACTGATGTGCCACAAAATTATTTTAAGGTATTTGTGTTTTAAGAGTGTTCTCATGAGATTAGTTGTAGATATTTTT
	TAAAATACAACTGGTTTTTAAAATCTGAGTATTGCTCTAAGCAAGTGTTTAGACTCTTACGGGAAGGTGGGTGGAAGTTGTTTGGCTTCCGTATTTCCAT
	GCGTGCCGTCAGACATAGGTCAGAACGCCAACTGTGCATCCTGCTGTTTAAAGACCTCTTGGCCTCTGTGACCCTCATGAAGGGGCTGATATTTTAAGTT
	GACTGTTTGATTGTAAATTAATCCTTTCTAATTTTTAAAGACTTGCTTGACTGTTTTCCTTGttaaataattttaaaaaaataaaaaaCTGGAAGTTCTT
	TGCT
Exon11b 102871830 - 102871837
	TAACTGTA

Links between exon parts

From
exon
To
exon
Splice
sites
SupportExamples
13+174dbEST_BY321840.1,dbEST_CD550652.1,dbEST_CA480747.1,dbEST_BY146473.1,REF_NM_010937.2,GB_X13664.1,GB_AK011704.1,GB_AK165960.1,GB_AK150357.1,GB_BC058755.1,GB_BC014704.1,GB_BC051443.1,
2b3+2dbEST_CN688220.1,NIA_E0254H01-5,
2c3+62dbEST_CJ169002.1,dbEST_CJ182889.1,dbEST_CJ175760.1,dbEST_AA114782.1,
34+5dbEST_CJ092862.1,dbEST_CJ092729.1,dbEST_BY709851.1,ENSMUST00000128264,GB_AK010412.1,
35+117dbEST_BY321840.1,dbEST_CD550652.1,dbEST_CA480747.1,dbEST_BY146473.1,REF_NM_010937.2,GB_X13664.1,GB_AK011704.1,GB_AK165960.1,GB_AK150357.1,GB_BC058755.1,GB_BC014704.1,GB_BC051443.1,GB_CT010359.1,
45+2dbEST_CJ092862.1,dbEST_CJ092729.1,
56+73dbEST_CD550652.1,dbEST_CA480747.1,dbEST_BY265748.1,dbEST_CJ172949.1,REF_NM_010937.2,GB_X13664.1,GB_AK011704.1,GB_AK165960.1,GB_AK150357.1,GB_BC058755.1,GB_BC014704.1,GB_BC051443.1,GB_AK010412.1,GB_CT010359.1,
67+46dbEST_BY710932.1,dbEST_BY743231.1,dbEST_BU148354.1,dbEST_BG242516.1,REF_NM_010937.2,GB_X13664.1,GB_AK011704.1,GB_AK165960.1,GB_AK150357.1,GB_BC058755.1,GB_BC014704.1,GB_BC051443.1,GB_AK010412.1,GB_CT010359.1,
78+47dbEST_BY710932.1,dbEST_BI683649.1,dbEST_CK030728.1,dbEST_BI689341.1,REF_NM_010937.2,GB_X13664.1,GB_AK011704.1,GB_AK165960.1,GB_AK150357.1,GB_BC058755.1,GB_BC014704.1,GB_BC051443.1,GB_AK010412.1,
79+2dbEST_BU704322.1,dbEST_CB247634.1,
89+52dbEST_BY710932.1,dbEST_BQ921954.1,dbEST_BU148354.1,dbEST_BI683649.1,REF_NM_010937.2,GB_X13664.1,GB_AK011704.1,GB_AK165960.1,GB_AK150357.1,GB_BC058755.1,GB_BC014704.1,GB_BC051443.1,GB_AK010412.1,
910+2ENSMUST00000128264,GB_AK010412.1,
1011a+2ENSMUST00000128264,GB_AK010412.1,