NIA Mouse Gene Index (mm92)

Exon structure for U003659

chr3 +

Exon1 102975578 - 102975788
	CCGAATCGAAGCCCCAAAGGCAGCGGCGTGTGTGACGTCATTCCAGGCGCAGGCGCAGTGGAATTAGAACCGAGGCTGCGCAGACTCAGAAGGCGCTCTT
	GAAGCCTAGTGCCGCGCGATGGCGGGCACGGGCTTGGTAGCCGGAGAGGTGGTGGTAGATGCGCTACCATATTTTGACCAAGGCTATGAGGCACCCGGCG
	TGCGGGAAGCG
Exon2 102975871 - 102975963
	GCGGCGGCCCTGGTGGAGGAGGAGACGCGCAGATACCGACCTACCAAGAACTACCTGAGCTACCTGACGGCCCCGGATTATTCTGCCTTTGAA
Exon3a 102977157 - 102977197
	CATGATTCTGTTACTAATTCTTTGTGGTGTTTGTGCATCAG
Exon3b 102977198 - 102977268
	ACAGACATAATGAGAAATGAATTTGAAAGACTCGCTGCTCGACAACCGATTGAATTACTCAGCATGAAACG
Exon4 102978263 - 102978424
	ATATGAACTTCCAGCCCCTTCCTCAGGTCAAAAAAATGACATTACTGCATGGCAAGAATGTGTAAACAATTCTATGGCTCAGTTGGAGCACCAGGCGGTC
	CGGATCGAGAATCTGGAGCTGATGTCACAGCATGGATGCAATGCCTGGAAGGTGTACAATGA
Exon5 102979542 - 102979592
	AAATCTTGTTCATATGATTGAACATGCACAGAAAGAGCTTCAGAAGTTAAG
Exon6 102981262 - 102981342
	GAAACATATTCAAGATTTGAACTGGCAGCGAAAGAACATGCAGCTTACAGCTGGATCTAAGCTGAGAGAAATGGAGTCAAA
Exon7 102982278 - 102983089
	CTGGGTGTCGCTGGTGAGTAAGAACTATGAGATTGAGCGGACGATTGTCCAGCTGGAGAACGAGATCTATCAGATCAAGCAGCAGCACGGGGAGGCCAAC
	AAGGAAAACATCCGCCAAGACTTCTAATGACTCAGGCGACGTGGGCTCCGCAGACTCAGCGGGGACTTTCTCGGAGCGACTGTGGTGGTTACATGGTTAG
	AGACCATGGACTATGTAAACTGTTGTATTGCTTCTGTGTGAGTGTCTTAGCAAAATAAAGTTGTCAACATGTTGCTGTTTTTATGCTATAAAAACCTGGT
	TTTCAGAATGAGTATGACTTTAGAATAATTTTGACATATTTTGTAGCAGAATTTTTTTTTTAAGGCTTCAAATTTTGTAATGAAGCTCCTTTATTTTTAA
	GGCATCCAACATGTTCTGGAAGCTGGAAACCTTGAATTTGTGTTTTTTGTTGAATAAAGTTACAGTTCTAAGCATTTTTATGTGTGGCTATAGTGAACTT
	TATTGATGGTATTCAAAAGAATGAGGCTCCCTTCTAGGGATCTATGATAGAAATAGGtgtagtgagaattgtggaattttggattcttttttaaaaatgc
	agaaatataagaatatgttttgggctggtgagatggctcagcgggtaagagcacccgactgctcttccgaaggtccggagttcaaatcccagcaaccaca
	tagtggctcacaaccacccgtaatgagatctgattccctcttctggagtgtctgaagacagctacagtgtacttacatataataaataaataaatcttaa
	aaaaaaaaagaa

Links between exon parts

From
exon
To
exon
Splice
sites
SupportExamples
12+192dbEST_EL956769.1,dbEST_BB649336.1,dbEST_BY128869.1,dbEST_BY073999.1,REF_NM_026602.3,GB_BC013627.1,GB_BC037062.1,GB_AK018786.1,GB_AK005825.1,GB_AK020098.1,GB_AK166967.1,GB_AK153513.1,GB_AY043239.1,GB_BC023382.1,
23a+3dbEST_BI249654.1,ENSMUST00000135017,GB_BC023382.1,
23b+205dbEST_EL956769.1,dbEST_BB649336.1,dbEST_AA544668.1,dbEST_BY128869.1,REF_NM_026602.3,GB_BC013627.1,GB_BC037062.1,GB_AK018786.1,GB_AK005825.1,GB_AK020098.1,GB_AK166967.1,GB_AK153513.1,GB_AY043239.1,
3b4+218dbEST_EL956769.1,dbEST_BB649336.1,dbEST_AA544668.1,dbEST_BY128869.1,REF_NM_026602.3,GB_BC013627.1,GB_BC037062.1,GB_AK018786.1,GB_AK005825.1,GB_AK020098.1,GB_AK166967.1,GB_AK153513.1,GB_AY043239.1,GB_BC023382.1,
45+128dbEST_BU946134.1,dbEST_BG062782.2,dbEST_BI989294.1,dbEST_BU936598.1,REF_NM_026602.3,GB_BC037062.1,GB_AK018786.1,GB_AK005825.1,GB_AK020098.1,GB_AK166967.1,GB_AK153513.1,GB_AY043239.1,GB_BC023382.1,
46+2dbEST_BG921072.1,dbEST_BI653022.1,
56+105dbEST_BU946134.1,dbEST_BI989294.1,dbEST_BU936598.1,dbEST_BX515792.1,REF_NM_026602.3,GB_BC037062.1,GB_AK018786.1,GB_AK005825.1,GB_AK020098.1,GB_AK166967.1,GB_AK153513.1,GB_AY043239.1,GB_BC023382.1,
67+107dbEST_BU946134.1,dbEST_BG921072.1,dbEST_BU936598.1,dbEST_BB623999.1,REF_NM_026602.3,GB_BC013627.1,GB_BC037062.1,GB_AK018786.1,GB_AK005825.1,GB_AK020098.1,GB_AK166967.1,GB_AK153513.1,GB_AY043239.1,GB_BC023382.1,