NIA Mouse Gene Index (mm92)

Exon structure for U004025

chr3 +

Exon1a 157609942 - 157610111
	GTCTTCCTACGTCGTTCTGAGGGAGGTTGACAAACAGGGTTTCAGCCTTTAAGCTAGAGTTCGTAACTGCCGTTGACCTCCTCCTTTACGAAGGCCCAGA
	GCACCAGGTCAGAGCTCTGAGTCTGGGTCTGAATTCAGCCGCAGGGCCCGGCCCAGGGTGGAACCCTGTG
Exon1b 157610112 - 157610714
	CGAGAGGAGCGCGGGCGCTGCCCGGACCCTGACCCAAGCGCAGAAGCGGCCCTCTAACACTCCGCGGCGGCGTTTCCTCCGAAGCTCTCGCGAGAGGAGC
	CGGGGAAAGATGGCTGCGCCGGGTCTTTCCGAGTGAGGAGGAggcggcggcggcggcgccgggcgTCGTGCGGTCGTGGTCTCTTGAGCTGCGGCTTTCC
	TCGTCCGAGACGAGGGCCGCCGCCTCCGGGAGATGCGCGTGTCGCGGACCCGCGGTCGCCCCGGGAGTTCATGCTGCGTGCTAGGCTCGCGGCCGCCGCT
	CTAATcgcccggcgccgccgccgcgccggctcggcccgcggTGAGCCTCCCGGAGCCTGTCCCGCGCGCCGCGGCGGCTATGACCGGGGAGAAGATCCGC
	TCCCTGCGGAGGGACCACAAGCCCAGCAAAGAGGACGGGGACGTGCTGGAGCCCTGCGAGGAGGAGGCGACAGCCGCGCTCGGCGGCGCCTTCACCGGGG
	GCAGAAGCGGACCGGGCGGCAGCGGCAAGGGCGGCAAGGCCTGCCATAAGATCTTCAGCCACCACCACCGGCTGCAGCTGAAGGCGCCCGCCGTTCCGGG
	CCC
Exon1c 157610715 - 157610920
	CGGCGTTCCGGCCCCGCCGCAGCACAACGCAGTGACTGCCACCTGCCCTGCCCCGGCCTGCCTGGGCGGCAGCAACCCCGCTTTAGTCGCTGACGGAGGC
	GGCTGCCCCTCGCTCTACCCGGTCCACGAGTGCGTCTTTAAGGGGGACGTGAGGAGACTGTCCTCGCTCATCCGCACGCACAATATCGGACAGAAAGATA
	ATCATG
Exon2 157623948 - 157623989
	GAAACACTCCTTTACATCTTGCTGTGATGTTAGGAAATAAAG
Exon3 157625242 - 157625346
	AATGCGCACATTTACTGTTGGCTCATAATGCTCCAGTAAAGGTGAAAAATGCTCAGGGATGGAGCCCTCTTGCGGAAGCCATCAGCTATGGAGACAGACA
	GATGA
Exon4 157635196 - 157635281
	TCACAGCTCTTCTAAGGAAACTCAAGCAGCAATCTAGGGAGAGTGTTGGAGAAAAACGACCTAGGTTGTTAAAAGCCCTAAAAGAG
Exon5 157635964 - 157636009
	TTAGGTGACTTTTACCTAGAACTTCACTGGGATTTTCAAAGCTGGG
Exon6 157638192 - 157638258
	TGCCTTTGCTTTCCCGAATTCTGCCTTCTGATGCCTGTAAAATATACAAGCAAGGTATCAACATCAG
Exon7 157651604 - 157651748
	GCTTGACACAACTCTCATAGACTTTACTGACATGAAGTGCCAACGAGGGGATCTAAGCTTCATCTTCAATGGGGATGCTGCACCCTCTGAGTCTTTTGTA
	GTGTTAGACAATGAACAAAAAGTTTATCAGCGAATACACCATGAG
Exon8 157654645 - 157654776
	GAGTCAGAGATGGAAACAGAAGAAGAAGTTGATATTTTAATGAGCAGTGATATTTATTCTGCAACTTTATCAACCAAATCCATTTCTTTCACACGTGCCC
	AAACTGGATGGCTTTTTCGGGAAGATAAAACA
Exon9 157656599 - 157656749
	TTACTTGTCTGTACTCTGTTCTTCTGGGCAGCATTAGATGGATCTCCCCAAGAGAAGATAAATATTGAAAACTGCTGTCCACCTAGTGTTACCACTAAGC
	AGCCAAAAGCTCTTGAGGAGCGGCTAGGTGACCTCCTTAAGTCGTTGACAG
Exon10 157657561 - 157657722
	GAAAGAGTAGGAAACTTTTTGGCAGACTTTTATCTGGTGAATGGACTTGTTCTAGAATCAAGGAAAAGGAGGGAGCACCTGAGTGAGGAGGACATCCTGC
	GGAACAAGGCCATCATGGAGAGCCTGAGCAAAGGGGGGAGCCTGGCGGAGCAGAGCTTTGAG
Exon11 157662621 - 157662700
	CCGGTTAGAAGACAGTCCCTTACCCCTCCTCCTCAGAACACTATTACGTGGGAAGAATACATATCCGCTGAAAATGGAAA
Exon12 157664038 - 157664136
	GGCACCACACCTGGGCAGAGAACTGGTGTGCAAAGAGAGCAAGAAAACATTTAAAGCCACTGTAGCCATGAGCCAGGAATTTCCCCTGGGAATTGAGTC
Exon13 157666673 - 157666773
	ATTGTTGAATGTTCTAGAAGTAATAGCACCCTTCAAGCACTTTAACAAGCTTAGAGAATTCGTTCAAATGAAGCTTCCTCCAGGCTTTCCTGTAAAATTA
	G
Exon14 157668704 - 157670990
	ATATACCCGTGTTTCCCACAATCACAGCCACTGTGACTTTTCAGGAGTTCCGATGTGATGAATTTGATGGATCCATCTTTGCTATCCCTGAAGACTACAA
	GGAAGACCCAAGTCGTTTTCCTGACCTTTAACTGATCCAGAAGAGCATGAGGCTCCAGGTGGCAAAGGCAGAGCTTTTCTAAGCAGAGTGTCAACACATC
	AGTGATGTGATGAAAAACTGACCTCTAATAAAACATCCACAGCTTCCTGATGTGCCATTCATTCATCTTTTTAAAGTCACTTCCTGTCTGTAATAGTTTG
	ACACCCAGTGACCCTGAGACCTTCCTATGTAAAGCAGCTGTGAGTGCTGTGATTTGTTTTTAAAGATTTTTACACTTCTTGTTGAAATATATATCAAATA
	AATATATCTATAGCTATATCTAAAACACTCCTGGACCATTAACGTAAATTCTGTGTCTTAAGAGATATGAAACCCTTTGAAATGCGTCACCTCTATTCAG
	GGTGGCATGTATAAATGTTCCTTTAAGCTTTGTTTTCATCATTATGTATAGTTCTGTAATTTGAATGTTTAACCAACTAGAAGGAATGCAGTTTTCTGAG
	GTGAACAGAGCAATGGTAACCATCAGTTTCATTTACAGCCTGTTGCAATACATTCCGAGGGAACGCTCCCTGCAGGGAATGTGGTGCCCCCCCCCCCCCC
	CAGCACCTTGATAACAGTTGCATTTATAGCTGCAATGCATTCCAAGGGAGTGCTCCCTGCAGGGAATGCGGTGCCCCCCAGCACCTCCATGCAGCTCATC
	GTGGTGCTCTTTGTTTCACCTGAATCCTTTTTCAGTGGAAACTGTTTGTTACTGATCTTCCTTTCATAGAGCTTCTATTTTTTTTTTTTTTTTTCCTAAA
	CTTGAGTTTAAAGGTCCTTGTTCTGTTGATAGGTACGGTAACATGCTTACAGCTAGCCCTCTCCTAAGTATCAGCACTTTAAACAAATTCCAAATTTTTA
	AACTTGCTTCCTAGTAAGTGCATGTAAGTCAGATTATTTTTAATGGAATATGGATGCATTGGTGTCAATTTTAAAAAATAAATATGTATTTTGGACAATT
	ATGTATTAATGATTTCAAAATAAGGTAAAAACATTTTATATGTAACAATATATTTGTTATAGGCTAAACGTCCAGAAACACACAAGATTGAAAGTTCTTT
	TTTTTTAAGTCATAGGAAAATAATTATTGATTTGTCTCCAAAGTGTTAAAATCATGCATTACTCACTTTTACACCtaaatttttttcatatttattaaaa
	aataGTTTAAAGATCCAAGAAAGAAAAGTAGGGAGAATAATGTTCAAATCACAATAGTATCATGTTTTATTAAAGACTTAGCTAAATGTTTGTGTCCTGA
	TGAGATGTGTCAAGATACATTTGTCAGGTTGTTACAGTGTGACTAGTAGTTTAAACTTTGACCAAGACTTTTATTGAAAGATGACTTATTTAAAAATCCA
	AAGTGTTAGCCATAAGATAGTTCTCTCTCTCTCTCTCttttttttttaaatttatttaatgtgggtacactgtagctgtcttcagacacaccagaatagg
	gcatcagattccattacaggtggttgtgagccaccatgtggttgctgggaattgaactcaggacctctggaagaacaggtagtgctcttaaccactgagc
	catctctccagtcccCGATATTTATCTCTTTACAGTTGCATCTCACATAGTGATACCACCTGGCATATGTTGACATTTTACTTTTTCTAAGAAAAATAAT
	TGAGTTAAAAAAATCAAAGCCCTCACCACTCCAGTAAGTGATCTATTTAGTTTTAAGAACTGAGAAGCCCAAAGCTAGCATGATGAAATGGAGGCAGTGG
	CTGATCCAGTGACTTAGCTATTTAGTTCTGTTGTCAATCATGATTCCAAGGTTCTGAAAGGCAGTGACACTGTTGCTTTAGGCTCATTGGCTTGAACATG
	TAGGAAGAAATGATAAATTTGCAGCTTGGGATTTAGAATTTCTTAAACATGTGAATATTTTGCTGGGTAACACTGGAGATAGGACTACTGAAAATTGTTG
	CACTGGATTGTACTACTGAAAATGGTTGCACTGGATTGTTTTGAGACTTCAATTTACCTTTAATGAGTAGTAGAATCAGATTGTCCATTCCAAAATGTTT
	TTTCTCTGATCACAAAGAACAAGTGTATCTCTTATGATGGTGGAAAAAAAAGGAGTTAATTAATGCAAATAAACTTTTCACAATATT

Links between exon parts

From
exon
To
exon
Splice
sites
SupportExamples
1a1c-1dbEST_BY234516.1,
1a1a-0
1c2+37dbEST_AA389034.1,dbEST_BY719834.1,dbEST_BY751496.1,dbEST_CB527885.1,REF_NM_001013806.1,GB_AK135906.1,GB_AK157542.1,GB_BC065088.1,GB_BC138991.1,GB_BC138992.1,
23+38dbEST_AA389034.1,dbEST_BY719834.1,dbEST_BY751496.1,dbEST_CB527885.1,REF_NM_001013806.1,GB_AK135906.1,GB_AK157542.1,GB_BC065088.1,GB_BC138991.1,GB_BC138992.1,
34+42dbEST_BY719834.1,dbEST_CB527885.1,dbEST_CK619145.1,dbEST_BE631790.1,REF_NM_001013806.1,GB_AK135906.1,GB_AK157542.1,GB_BC065088.1,GB_BC138991.1,GB_BC138992.1,
46+1GB_AK157542.1,
45+40dbEST_BY719834.1,dbEST_CK619145.1,dbEST_BX525523.1,dbEST_BU611407.1,REF_NM_001013806.1,GB_AK135906.1,GB_BC065088.1,GB_BC138991.1,GB_BC138992.1,
56+36dbEST_BY719834.1,dbEST_BU611407.1,dbEST_CJ161307.1,dbEST_CN712080.1,REF_NM_001013806.1,GB_AK135906.1,GB_BC138991.1,GB_BC138992.1,
67+36dbEST_BY719834.1,dbEST_BU611407.1,dbEST_CN712080.1,dbEST_CN711699.1,REF_NM_001013806.1,GB_AK135906.1,GB_AK157542.1,GB_BC065088.1,GB_BC138991.1,GB_BC138992.1,
78+29dbEST_BU611407.1,dbEST_BI732775.1,dbEST_BQ562764.1,dbEST_CK334038.1,REF_NM_001013806.1,GB_AK135906.1,GB_AK157542.1,GB_BC065088.1,GB_BC138991.1,GB_BC138992.1,
810+25dbEST_BI732775.1,dbEST_CN461807.1,dbEST_CA326757.1,dbEST_CF583766.1,REF_NM_001013806.1,GB_AK135906.1,GB_AK157542.1,GB_BC065088.1,GB_BC138991.1,GB_BC138992.1,
910+2dbEST_CJ068436.1,dbEST_BB574287.1,
1011+46dbEST_CA326757.1,dbEST_CF583766.1,dbEST_CK621222.1,dbEST_CF583765.1,REF_NM_001013806.1,GB_AK135906.1,GB_AK157542.1,GB_BC065088.1,GB_BC138991.1,GB_BC138992.1,
1112+26dbEST_CF583766.1,dbEST_CK621222.1,dbEST_CF583765.1,dbEST_CF736962.1,REF_NM_001013806.1,GB_AK135906.1,GB_AK157542.1,GB_BC065088.1,GB_BC138991.1,GB_BC138992.1,
1213+36dbEST_CF583765.1,dbEST_CF736962.1,dbEST_DV045565.1,dbEST_CF533055.1,REF_NM_001013806.1,GB_AK135906.1,GB_AK157542.1,GB_BC065088.1,GB_BC138991.1,GB_BC138992.1,
1314+37dbEST_CF583765.1,dbEST_CF736962.1,dbEST_CF533055.1,dbEST_CF616244.1,REF_NM_001013806.1,GB_AK135906.1,GB_AK157542.1,GB_BC065088.1,GB_BC138991.1,GB_BC138992.1,