NIA Mouse Gene Index (mm92)

Exon structure for U004690

chr4 +

Exon1 116230237 - 116230433
	GCGGCAGAGGGAGGGCCCAGCCGGCCGTCGCTCCTCCTCCACCCGCTCTGCCCCCTCCTGGGCCTTGTGGGCCGGGCAGCCATTTTGGGAAGAGCTTTGT
	TATGGTTGTGGGCTAGTCACCTCTGCTGGTCGGAGAAGCTGAGGACGCGTCCTCAGACGCCGCGAGTCGTCCTTGACCGTAGCCCCGCCGCTGCCGG
Exon2 116230684 - 116230754
	AACTTCAGTTCCCGGTCGGAAACGCTCACCTGCGGCTCCGGCTCCTCTCCAGGAGTTCCGGCTTGATAGTG
Exon3 116241769 - 116242786
	AGATTGGCAGACTCAAGTGGCCTTTTTAATGTTTGAGTAATGATGGAGATGGACCCAAATTAGAAAGTGATTTCTTCAATAAAGCAATAGAAGATTCTTC
	CTATCTTCTGGAAGCTCAGTCCAGTTTTGGGGAAGGAGGAGAACAAGTGAAATACAGAAAATTGATAAGAAGCAAACCTCATTTTGGAATTCTCTTTTCT
	TCCTGACCCTTATCTTTTCTACTTATAATTTTGCTTTGAATGTATAAATAGTAAAGACCAAAGAAATAGGGATATATATTTAGGAGCTTTATACCAAGAA
	ATTTGCCTTGAAAGCTGCTATTCTGTGGCAGGAAAACTATATCAAGTTTCTATTGGATTCCTTTTTCAAAAAACAAAACAAGACTTCTTATATCTTTAGA
	TTTTGAAGGTTAAAACTATAAAAGCACATCTCTCTGCACAATGCTTTAAGCAGTTGTGTGAGATAGTGAGATTTATGTTAAAAGCTTCTGTTGTGGATAG
	TTTGCCACTGGAATTGATTGTGCAGAAGCTCTCTTACAGTGCTTTACTATTACATTTGACCTGTCACCTTGATGACATTTCTTGCCCACATCTGAGACCA
	TTTGTCCTTGTAGCCATGACCTTGTTATGAACAGTGCTTGCACTCACTGTGCAGATGTCCATGTTTTGCCTATTTGAGCAACATTACAGTGCCATTACTC
	AAGGCAGTTGAATGAGGTGAACATAGACATAGCTTCCCCCCTTTCCCCCCTTTTTTAAATGTAACAAATAACCTTTTATGTTCCCCTTCCcccccttccc
	ctccccctcccccCTTTGGAAAAGTGTTGGGAAGGAGGTATTGAGGATGAGCCGTTGAGAGGATTAAGAGGGTGGGCCACACAGAGCTGGGCTTTTTTGT
	GCTTCATCACAAGGCGTGCTGCTGGCCAGGCTATTTTAGCACCCTTCTTACAAGAACACCTCGTGGAAGATACAGGCGGCAACTTTGGATACAGGACCAC
	AGAGGTGACACTCTGAGG
Exon4 116243476 - 116243588
	ATCCTGGCCATGAGGTTGGATGCCTCATCTTGCTAAAAAGACACTGGACCTAAATGGCGCAGCATGACTTTGTTCCTGCTTGGCTAAATTTCTCAACGCC
	ACAGTCATCTAAG
Exon5 116245999 - 116246128
	TCATCTACAGCCACCTTTGACAAACACGGAGAGCACCTATCCCGTGGAGAAGGTAGATTTGGAATAAGCCGTCGTCGACATAATTCCTCTGATGGCTTTT
	TTAACAATGGACCTCTACGGACTACGGGAG
Exon6 116246942 - 116247219
	ATTCTTGGCACCAACCCTCCCTATTCCGCCATGATTCTGTTGACTCTGGTGTCTCTAAGGGAGCATATGCTGGAACCACAGGTTGGCATGGCTCTTCCCG
	AGGTCATGATGGTATGAGCCAACGTAGTGGAGGTAGTAGTACAGGAAACCACCGACACTGGAATGGCAGCTTCCATTCCCGGAAAGGCTGCGCCTTTCAA
	GAAAAAACACCAACTGAGATTAGGGAAGAAAAGAAAGAGGATAAAGTAGAAAAGTTGCAGTTTGAAGAGGAAGACTTC
Exon7 116251852 - 116251924
	CCTTCTTTGAATCCAGAAGCTGGCAAACAGAATCAGCCCTGCAGACCTGTTGGGACCCCTTCTGGAGTGTGGG
Exon8 116253855 - 116254048
	AAAATCCACCTAGTGCCAAGCAACCCTCAAAGATGCTAGTCATCAAAAAAATTTCCAAAGAGGATCCTGCTGCTGCCTTTTCTGCTGCATTCACCTCCTC
	AGGATCCCACCATGCAAATGGGAACAAAGTGTCAACAATGGTCCCAAGTGTCTATAAGAACTTGGTGCCTAAGCCTGCACCACCTCCCTCTAAG
Exon9 116259976 - 116260116
	CCCAACGCCTGGAAAGCTAACAGAACGGAACACAAACCTGGATCACTTTGCTCTAGCCGGGAGTCTGCTTTCACCAATCCAATTTCTGTTACTAAACCAG
	TGGGACTGGCTGCTGGTGCAGGTCTCCACTCTCCCAAAGAG
Exon10 116261184 - 116261348
	AGTCCCTCCAGTACTACCCCTCCAATTGAGATCAGCTCCTCTCGTCTGACCAAATTGACCCGACGAACCACAGACAGGAAGAGTGAGTTCCTGAAGACTC
	TGAAGGATGAACGAAATGGAGACTGCTCAGAAAGTAGAGACTGTGACAAGCTGGAGGGGCTAAGA
Exon11 116262771 - 116262895
	TTGGAGGGCAGCCACACACCCGAACCAAAGGAAAATGGAGAACAAGGTTGTCTTCAGAACGGTCTTTCTCTACCCATGGTAGAGGAAGGGGAGGTTCTGT
	CACACTCTCTGGAAGCAGAGCACAG
Exon12 116263834 - 116263936
	GTTATTAAAAGCAATGGGGTGGCAGGAGTACCCTGAAAATGATGAGAGCTGCCTTCCACTCACAGAGGACGAGCTCAAGGAGTTCCACCTGAGAACAGAG
	CAG
Exon13a 116265411 - 116266047
	CTACGAAGAAATGGGTTTGGAAAGAATGGCCTCTTACAAAGCCGTAGTTGCAGCCTGTCCTCCCCGTGGAGAAGCACTTGCATTGCAGAGTGTGAGGACT
	CAGACTCGGAAACGAGCAGCAGCCAGACGTCAGACGACGATGCCTGGAAGTAGAGATAAAATGCTCACAGTGACCTGCCCCGCTGAGCTCAGCCTTGTGT
	TTAGAGAATATAAAGTGTTCTTTTCCTTTTCTTATGTTGTTGAATACTTCATGCACAAGGGAAATAATCATATCCCAAAGAGAGAGCAATTGTCTTGCTT
	AGCCTTTGTTTTCTTCCCTGTTACCTGCTTAATAGGCATTTGTGTGGTGGGATTTTTTTAAGCACACACACAGTACCTGTGGGGCTGTGCACAAGTGGGA
	GCTGTCAGGGCAGAGATGCAGGGAGGAGATGCTGCTCTGCTCAACAGCTTCTACTACCAGCCCTTGGGGACTCACCCCTGTGCTCAAGCAATCATTGTCA
	ATGACAAAGTGACTATTGAAGTTATAATTGTATTAAATTAATGCTAATAATTTGGATATTTTATTTTATTTTTGGCTGCTGGGTAACTTAGCCCTTAACC
	AAGCATATGTGGTTGtttttgtttttttttttttttt
Exon13b 116266048 - 116266487
	gttttgttttgttttttattttctctttttttttttttttcttttGGGTACAGCTGTAAAATATTTGGATATAGGAAATGTTATTCTTGCAGCCTTGATA
	TTCAGGGTGGATTGTAAAATATGAATTTTTGTGAGATTTCAAAGATTAAGATTATTTTGATAACATTATTTACAGATTTAAAAGATGTGGTTACCACAAG
	TCTGTTGAGGGGAAAAACTACTGCATAAAATAACTAACGTCGAATAAATATTTTGCATCAGTTTGGATTGTCTTGTGTAAGAAATATATTTTCTTTAAAA
	TTAGAGAGTGGATTCTTTTTTTAAGGGAAATATTTTTAGAAAACTAGGGGAAAACTGAATTCAGCCCCACCTGTTTCTCTTTTCAGCAAAAATTCTTAAT
	GTGGAAAAAACCTGTGCAATAAATTATTCATAATAAACTA
Exon14 116269259 - 116269562
	ACATTTGAAGGACCTGGCGATTTAGCAGACTTGGTCTATTCTTTGTCCCTTTTCTCTCTTTTCTGTCCAGTCCGCCTTTTCTCTTTTGTCACATCCTCTG
	TAGGACGCTGGTGTCTATAAGAGATTCCATTCCATGGCCGATTACTCAGGGGAATCAGGACTTTTATCCTGTGAATCCTGTGATATGGTTTTCCGCTCCT
	GGGCTCTGTTGGCCACACACACCAAACGATTCTGCATTGGCCGGCTGACTCCGGAGGTAACACTTAAATCACAGCCTTCAGTCGCGATCAAACGAGGCAC
	CAAG
Exon15 116269638 - 116269706
	ATCATGGCACAAGAAAAGAGCCGTGATCAGGAAGCCAGCACATCTGCTCTAAAGAGGCTGACAGAGGAG
Retained Intron 116269707 - 116269867
	GTACACACCAATCATGACTACAAACTTCAACTTTACATGTGTAGAGATTTACATGCTGGAAATCACCCAGTACAGAAATAGCGGGTCCGAGTTATTTGCA
	GGTGCAGTTGCTGTCCCTACAGAAAATAGGTCCCCGAGCGACTGAGGGTCTCACTTCCCAG
Exon16b 116269868 - 116269973
	ACTGCAGGGAGCCCTGGGGAGAGGCTGCGAGTCTTGCAGGGAACCCGCGCCAGACGCATGGCAGAAACAGAAGCACAGAGCCGGGCGCTGGAGCGTCGCG
	GCGAAG
Exon16c 116269974 - 116269980
	GTGAGAG
Retained Intron 116269981 - 116270042
	GTAAGGACTCGGCCCTGTCGCTGTGCTCGGACTCACCCTGACTCTGCCCATTTGTCCCTCAG
Exon17b 116270043 - 116270064
	AATTAAAACGGCGCCTCCACAG
Exon17c 116270065 - 116270205
	CGTGGCGGGACCCAAGGGAGGATTACCCCGCCCATTCGACTTGGAGCGCGAGCTCAGAGAACTCAAGGAAGAGGCCAACCGGACCCGGGGAGCACTGCAA
	ACGCTAGGTGCGCATTTCCAGGCGCTCCAGCTTCAGCCTCG
Exon18 116270285 - 116270368
	AAAACTGCAGGACACCCATAGGGCAGTGGAATTCTGTTACCTGCCCCTGCGGTTCAACCCGGAAACGCTGGCTGCAGAGATCCG
Exon19 116270448 - 116270566
	GATCCTACGTGAAGCCTACGTGCACGGTGGAGGCCGGGACCCAGAAGTTCTGGACAAAATATTGCAGCTGCAAGTGGAAGCGTCAGCCCTGGAATTGCAG
	CGGTCGCAAAACCGCAAGG
Exon20 116270779 - 116270892
	AAAAACTAAGTGCCGCCTCTGAGGAGGTTCTAACGGTGGAAGCCGAAAACAGGCTCCTGGAGGCAGAAATCCTGGCATTGCAGAAGCAGAAAGTCCTGAG
	TCTGTCGCCCTGGG
Exon21 116271105 - 116271232
	GATCCAGGGATCTCCCCGGACACCTGAGTAGGTGTGATAACTCCCTCCTCCCTCCACTGGTTGCACCCCCAATACCACAACTTACAAGTTCCACAAAAGC
	CCAGAACTTCCATGGCACTTCAAAGACT
Exon22 116271336 - 116271430
	ATACTTAATGGAACCATGACAAGAAAAATGGGTCTGGATCTCCACTTCCTCCTACCTGCATCAGATGTTCTAGGTCCAGCACCCTATGATCCTGG
Exon23 116271566 - 116271769
	GGCTGGCCTTGTCATTTTCTATGACTTCCTGCGGGGCCTTGACACTTCTTGGATATGGGTACAGCTAATGACCAGCTTGGCCCGGAATGGACAAGATACA
	GGAGGGACCACAGCATTACCTCCAGCCCTTTGCTTGCCACAACCTTCAGCTCCTGGACCTATGGGCAACTGTGCTATCCTAGCAAGCAAGCAGCCTGTGC
	CCAG
Exon24 116271894 - 116272095
	GCTGCCTCCATCACCACTGGTATCTTTGATCTGTGAACTACAGGCCTGGCATGGAGTTACATGGGCACCACAACCAAAGGCTTGGGCCTCACTATTGCTA
	TTTGACCAAGATCTGAGGGTGCTTAGGGGCCGTTGGCGCCTCCCACTTCGGGTCTATCCTAACACCAGCCTCAGCCTTGCCCAGAGGAATGAGATTCCCC
	AG
Exon25 116272162 - 116272272
	GCAGGCCAGGCTGAGCTCTTTCTGAGGCTGGTAAATGCAAGAGATACAGATGCCCAGACATTGGCAGAGATCAACCCAGCAAATGCCCATGAATACCAGT
	ACCCACCAATG
Exon26 116272492 - 116272871
	GTGTCCAGTTCATCTGTGGAATCCAGCTTCTTCACCCACAGTTCTGCCTTTGCTGACCCCCCACCTCCCACAGAAGAGGCTTTTGTCAGCGTTAAGGATA
	AAAATGAGCACTTGAGTCCTCACCAGTTTTGACTGAAACACTGAATTTCTTCTAGACCTGCAGCTTTTTAAATGGGGTCTTGTAACAGTGGCCAACTACA
	TTTGATCCTAAAATACTGTGTGGCAAAAAAGAACTTAACCCAAACCCACTTTTCTTTAAACTAGCCAACTAGAATTTCTTCTGCATTTATTTTCCTTTTA
	TAAAGCAGGTCCAGGAGTAAATGTCTTCAAATATTTAGTTAAACTGGCTGGCATTCAACACTTTGAAAATGGCTTTACCT

Links between exon parts

From
exon
To
exon
Splice
sites
SupportExamples
13+39dbEST_BB841090.1,dbEST_BB612810.1,dbEST_BB630351.1,dbEST_BB852096.1,REF_NM_029868.2,GB_AK037224.1,GB_AK133761.1,GB_AK019942.1,GB_BC066034.1,
23+3dbEST_BB617048.1,ENSMUST00000106475,GB_AK077148.1,
34+17dbEST_BF780166.1,dbEST_BF137932.1,dbEST_BF144976.1,dbEST_BF142389.1,REF_NM_029868.2,GB_AK037224.1,GB_AK133761.1,GB_AK019942.1,GB_BC066034.1,GB_AK077148.1,GB_BC031428.1,
45+17dbEST_BB733892.1,dbEST_BF780166.1,dbEST_BF137932.1,dbEST_BF144976.1,REF_NM_029868.2,GB_AK037224.1,GB_AK133761.1,GB_AK019942.1,GB_BC066034.1,GB_AK077148.1,GB_BC031428.1,
56+25dbEST_BB733892.1,dbEST_BF780166.1,dbEST_BF137932.1,dbEST_BF144976.1,REF_NM_029868.2,GB_AK037224.1,GB_AK133761.1,GB_AK019942.1,GB_BC066034.1,GB_AK077148.1,GB_BC031428.1,
67+22dbEST_BG077174.2,dbEST_BI104780.1,dbEST_CA526471.1,dbEST_CB946798.1,REF_NM_029868.2,GB_AK037224.1,GB_AK133761.1,GB_BC066034.1,GB_AK077148.1,GB_BC031428.1,
78+24dbEST_BG077174.2,dbEST_BI104780.1,dbEST_CA526471.1,dbEST_CB946798.1,REF_NM_029868.2,GB_AK037224.1,GB_AK133761.1,GB_BC066034.1,GB_AK077148.1,GB_BC031428.1,
89+23dbEST_BE291382.1,dbEST_BE283273.1,dbEST_BF101252.1,dbEST_BG077174.2,REF_NM_029868.2,GB_AK037224.1,GB_AK133761.1,GB_BC066034.1,GB_AK077148.1,GB_BC031428.1,
910+20dbEST_BE291382.1,dbEST_BE283273.1,dbEST_BF101252.1,dbEST_BG801285.1,REF_NM_029868.2,GB_AK037224.1,GB_AK133761.1,GB_BC066034.1,GB_AK077148.1,GB_BC031428.1,
1011+23dbEST_AU260134.1,dbEST_AV280238.2,dbEST_AV457115.1,dbEST_AW910456.1,REF_NM_029868.2,GB_AK037224.1,GB_AK133761.1,GB_BC066034.1,GB_AK077148.1,GB_BC031428.1,
1112+20dbEST_AV280238.2,dbEST_AV457115.1,dbEST_AW910456.1,dbEST_AW825721.1,REF_NM_029868.2,GB_AK037224.1,GB_AK133761.1,GB_BC066034.1,GB_AK077148.1,GB_BC031428.1,
1213a+18dbEST_AV280238.2,dbEST_AV457115.1,dbEST_AW910456.1,dbEST_AW825721.1,REF_NM_029868.2,GB_AK037224.1,GB_AK133761.1,GB_BC066034.1,GB_AK077148.1,GB_BC031428.1,
13a1-2GB_BC031428.1,GB_BC002292.1,
1415+9dbEST_BB614351.1,dbEST_BB613867.1,dbEST_BQ713906.1,ENSMUST00000121907,REF_NM_001037916.3,GB_AK076542.1,GB_AK029257.1,
1416b+3ENSMUST00000069224,GB_BC150874.1,GB_BC172023.1,
1516b+4dbEST_BB613867.1,ENSMUST00000051869,REF_NM_001037916.3,GB_AK029257.1,
1517b+3dbEST_BB614351.1,ENSMUST00000121907,GB_AK076542.1,
16b17b+3ENSMUST00000051869,REF_NM_001037916.3,GB_AK029257.1,
16c17c+3ENSMUST00000069224,GB_BC150874.1,GB_BC172023.1,
17c18+11dbEST_BB614351.1,dbEST_BQ713906.1,ENSMUST00000121907,ENSMUST00000051869,REF_NM_001037916.3,GB_AK076542.1,GB_AK029257.1,GB_BC150874.1,GB_BC172023.1,
1819+13dbEST_BB614351.1,dbEST_BY110525.1,dbEST_BY108307.1,dbEST_CK793739.1,REF_NM_001037916.3,GB_AK076542.1,GB_AK029257.1,GB_BC150874.1,GB_BC172023.1,
1920+9dbEST_BY110525.1,dbEST_BY108307.1,dbEST_CK793739.1,ENSMUST00000121907,REF_NM_001037916.3,GB_AK076542.1,GB_AK029257.1,
1921+6dbEST_BB641374.1,ENSMUST00000151441,ENSMUST00000069224,GB_BC150874.1,GB_BC172023.1,GB_AK043689.1,
2021+8dbEST_BY110525.1,dbEST_BY108307.1,dbEST_CK793739.1,ENSMUST00000121907,REF_NM_001037916.3,GB_AK076542.1,GB_AK029257.1,
2122+12dbEST_BB641374.1,dbEST_CK793739.1,ENSMUST00000121907,ENSMUST00000051869,REF_NM_001037916.3,GB_AK076542.1,GB_AK029257.1,GB_BC150874.1,GB_BC172023.1,GB_AK043689.1,
2223+12dbEST_BB641374.1,dbEST_CK793739.1,ENSMUST00000121907,ENSMUST00000051869,REF_NM_001037916.3,GB_AK076542.1,GB_AK029257.1,GB_BC150874.1,GB_BC172023.1,GB_AK043689.1,
2324+13dbEST_AV253348.2,dbEST_BB641374.1,dbEST_CK793739.1,ENSMUST00000121907,REF_NM_001037916.3,GB_AK076542.1,GB_AK029257.1,GB_BC150874.1,GB_BC172023.1,GB_AK043689.1,
2425+10dbEST_AV253348.2,ENSMUST00000121907,ENSMUST00000051869,ENSMUST00000069224,REF_NM_001037916.3,GB_AK076542.1,GB_AK029257.1,GB_BC150874.1,GB_BC172023.1,GB_AK003161.1,
2426+4dbEST_BB265428.2,dbEST_BB225990.1,ENSMUST00000151441,GB_AK043689.1,
2526+11dbEST_AV253348.2,dbEST_BX633897.1,ENSMUST00000121907,ENSMUST00000051869,REF_NM_001037916.3,GB_AK076542.1,GB_AK029257.1,GB_BC150874.1,GB_BC172023.1,GB_AK003161.1,