NIA Mouse Gene Index (mm92)

Exon structure for U005211

chr4 +

Exon1 154998947 - 154999050
	ATCATCACGCTTCCGCGGAGGAAGTGACGACAATCCTGGCGCGCGCCGGGCGCTGTTCCTTCCCAGACTCCAGGACCGGCTGCGGCGGCTGTAGCGGCGC
	AGGG
Exon2 154999294 - 154999448
	GCCTCCCCGCGTCCTGGAGCTTTCTCATACAACCTTTTGACACCTAAGGCAGAGTGTGTTGAGTGCGAGGCACTGAAATGACCTGGATGGTCTTTCATCC
	TAGAACAGTACCGTTACGTGGATGATGATGGTTGCGTTTTACGGAAAACACTGAG
Exon3 154999640 - 154999763
	TGTTTTAACTCAAATGGGTGATGAAAAGGACTCTTGGAAAGTGAAAACGTTAGATGAAATTCTCCAGGAAAAGAAACGAAGGAAAGAACAAGAGGAGAAA
	GCAGAGATAAAACGCTTAAAAAAT
Retained Intron 154999764 - 154999835
	GTAAGCTATGTTTTTTAAGTAAGTGGTTTTCTTAAAGAAGATTTAATTTCTTTGCCCTCATTTTTCCATTAG
Exon4b 154999836 - 154999882
	AACAACGCTTCTTCGGTGAAGTTCTTTTGTACTTCCAAATGTCACAG
Exon5 155000883 - 155000998
	TCTGATGACCGCGATTCCAAAAGGGATTCCCTTGAGGAGGGGGAGCTGAGAGATCACCGAATGGAGATCACAATCAGGAACTCACCATATAGAAGAGAGG
	ATTCTATGGAAGACAG
Exon6 155002805 - 155002932
	AGGAGAGGAGGATGATTCTCTGGCCATCAAACCACCCCAGCAAATGTCTCGGAAAGAAAAGGCTCATCACAGAAAAGACGAGAAAAGAAAAGAGAAACGT
	CGACATCGTAGCCATTCAGCAGAGGGAG
Exon7 155004303 - 155004441
	GGAAACATGCCAGAGTGAAAGAGAAAGAAAGGGAGCACGAACGCCGGAAACGCCACCGAGAAGAACAAGATAAAGCTCGAAGGGAGTGGGAAAGACAGAA
	GAGGAGGGAAATGGCGAGAGAACATTCCAGAAGAGAGAG
Exon8 155008198 - 155008334
	GGACCGCCTGGAGCAGTTAGAAAGGAAGAGGGAGCGGGAGCGCAAGCTGAGGGAGCAGCAGAAGGAGCAGCGGGAGCAGAAGGAGCGGGAACGGAGGGCA
	GAGGAGCGCCGCAAAGAGAGAGAAGCGCGTAGGGAAG
Exon9 155012629 - 155012751
	TCTCTGCACATCACCGTACCATGAGGGAGGAGTACAGTGATAAGGGGAAGGTTGGCCACTGGAGCCGCAGCCCTCTGAGGCCACCAAGAGAGCGCTTTGA
	GATGGGAGACAACCGGAAGCCAG
Exon10 155012993 - 155013100
	gaagaggcctcatcaggtaaaagctcttgctgaatgggatccacatgacggaaggagaaaactccttgcacaggttgtcctctgacctccacacatgctc
	ctaatgag
Exon11 155013703 - 155013798
	TAAAAGAAGAGAAGGTGGAAGAGAGAGACTTGTTGTCAGACCTCCAAGACATCAGTGACAGCGAGAGGAAAACCAGCTCAGCTGAGTCTTCATCAG
Retained Intron 155013799 - 155013885
	GTATCGCGAGGCCACCTGGCTGAGGCTTTGCTGCTGCCAGAGGAAAGCCAAGACTTACTTTTTAACTGTGATTGTTGTGTTCTGTAG
Exon12b 155013886 - 155014050
	CAGAATCAGGCTCAGGTTCTgaagaggaggaggaggaagaagaagaggaagaagaagaagaagggagcaccagtgaagaatcagaggaagaagaggaaga
	agaagaggaggaggaagaagaggaGACTGGGAGCAACTCTGAGGAGGCCTCTGAACAGTCCGCAG
Exon13 155014856 - 155014921
	AAGAAGTCAGTGATGAGGAAATGAGTGAAGATGAAGACAGAGAAAACGAGAACCACATCTTGGTTG
Exon14 155015624 - 155015799
	TTCCAGAGTCACGATTTGACCGAGATTCTGGGGACAGTGAAGAAGGGGAGGAAGAAGTTGGTGAAGGGACTCCACAGAGCAGTGCCCCCACCGAAGGAGA
	CTATGTTCCTGACTCTCCAGCACTGTCACCTATTGAGCTAAAACAAGAACTGCCCAAATACCTGCCAGCCCTGCAG
Exon15 155016594 - 155016684
	GGATGCAGGAGTGTAGAGGAGTTTCAGTGTCTGAACAGGATTGAAGAAGGCACCTATGGGGTGGTCTACAGAGCAAAGGACAAGAAAACAG
Exon16 155021592 - 155021713
	ATGAAATTGTGGCTCTGAAGCGGTTAAAGATGGAGAAGGAGAAGGAAGGCTTCCCAATCACGTCGCTGAGGGAAATCAACACCATCCTCAAGGCCCAGCA
	CCCCAACATCGTCACCGTCAGG
Exon17 155021971 - 155022076
	GAAATTGTTGTGGGAAGTAACATGGACAAGATCTACATTGTGATGAACTACGTGGAACATGACCTCAAGAGCCTAATGGAGACCATGAAGCAGCCCTTCC
	TGCCAG
Exon18a 155022334 - 155022391
	AGATATTAGGAATTCGTAGAGCAAACAGAGCATCTGTGTGATCTCGTCACTTTCGCAG
Exon18b 155022392 - 155022401
	GGGAGGTGAA
Exon18c 155022402 - 155022513
	GACCCTGATGATTCAGCTGCTGAGTGGGGTAAAGCACCTCCATGACAATTGGATCCTACACCGTGACCTGAAGACCTCTAACCTCCTGCTGAGCCATGCT
	GGCATTCTCAAG
Exon19 155022595 - 155022702
	GTGGGCGACTTTGGGCTGGCTCGGGAGTATGGTTCACCCCTAAAGGCCTACACTCCAGTTGTTGTAACCCTGTGGTATCGTGCCCCAGAACTACTGCTTG
	GTGCTAAG
Exon20 155022826 - 155022942
	GAATACTCCACAGCTGTGGACATGTGGTCGGTAGGCTGCATATTTGGAGAACTGCTGACACAGAAACCTCTGTTCCCTGGGAAGTCAGATATTGATCAGA
	TTAACAAGATTTTCAAG
Exon21 155023121 - 155023269
	GACCTGGGTACTCCTAGTGAGAAAATCTGGCCTGGCTATAATGACCTCCCAGCCGTCAAGAAGATGACCTTCAGCGAGTATCCCTATAACAACCTCCGCA
	AGAGATTTGGGGCTTTGTTATCAGATCAAGGCTTTGATCTCATGAACAA
Exon22 155023531 - 155023720
	GTTCCTGACATACTACCCTGGCAGGAGGATCAACGCAGAAGATGGCCTCAAGCACGAATATTTCCGAGAGACTCCCCTCCCCATCGACCCATCCATGTTC
	CCCACGTGGCCTGCCAAGAGTGAGCAGCAGAGAGTGAAGCGAGGCACGAGTCCACGGCCTCCTGAGGGCGGCCTGGGCTACAGCCAGCTG
Exon23 155023801 - 155024047
	GGTGATGATGACCTGAAGGAGACGGGCTTCCACCTCACCACCACCAACCAGGGAGCCTCAGCTGCAGGCCCTGGCTTCAGCCTCAAGTTCTGAGGTCGGC
	TTGATGGACGTGGCCCGACTAGGTGGTGACAGCCAGACCTGCTGATGCTGAATCAGGGCAGCTTGGTTGTTTTTTCCACGTTGTTTGTTTTGGGGCAGGT
	TGTAAATTTGTAGAATTAAATGAAATTTTCCTTTTGGAGGGAAAGAA

Links between exon parts

From
exon
To
exon
Splice
sites
SupportExamples
13+35dbEST_AI006623.1,dbEST_BB581142.1,dbEST_BB619241.1,dbEST_BU503018.1,REF_NM_007661.3,GB_AK135402.1,GB_AK077668.1,GB_AK147133.1,GB_AK008283.1,GB_BC052920.1,
12+6dbEST_AV587056.1,dbEST_AW744317.1,dbEST_BY739008.1,dbEST_CA492790.1,
23+6dbEST_AA546645.1,dbEST_AW744317.1,dbEST_BY739008.1,dbEST_CA492790.1,
34b+5dbEST_BY317834.1,dbEST_BY739008.1,dbEST_CA492790.1,dbEST_CO424349.1,
35+39dbEST_AI006623.1,dbEST_AV445346.1,dbEST_AV575612.1,dbEST_AV488447.1,REF_NM_007661.3,GB_AK135402.1,GB_AK077668.1,GB_L37092.1,GB_AK147133.1,GB_AK008283.1,
4b5+16dbEST_AV452398.1,dbEST_BF124887.1,dbEST_BU503018.1,dbEST_BU708261.1,GB_BC052920.1,
56+57dbEST_AI006623.1,dbEST_AV445346.1,dbEST_AV575612.1,dbEST_AV488447.1,REF_NM_007661.3,GB_AK135402.1,GB_AK077668.1,GB_L37092.1,GB_AK147133.1,GB_AK008283.1,GB_BC052920.1,
67+35dbEST_AI006623.1,dbEST_AV445346.1,dbEST_AV575612.1,dbEST_AV488447.1,REF_NM_007661.3,GB_AK135402.1,GB_AK077668.1,GB_L37092.1,GB_AK147133.1,GB_AK008283.1,GB_BC052920.1,
78+55dbEST_AI006623.1,dbEST_BE308367.1,dbEST_BM947850.1,dbEST_BQ900473.1,REF_NM_007661.3,GB_AK135402.1,GB_AK077668.1,GB_L37092.1,GB_AK147133.1,GB_AK008283.1,GB_BC052920.1,
89+82dbEST_AL034747.1,dbEST_BB684762.1,dbEST_BF607177.1,dbEST_BG969359.1,REF_NM_007661.3,GB_AK135402.1,GB_AK077668.1,GB_L37092.1,GB_AK147133.1,GB_AK008283.1,GB_BC052920.1,GB_M58633.1,
911+81dbEST_AA413247.1,dbEST_AL034747.1,dbEST_AV573452.1,dbEST_AV270235.1,REF_NM_007661.3,GB_AK135402.1,GB_AK077668.1,GB_L37092.1,GB_AK147133.1,GB_AK008283.1,GB_BC052920.1,GB_M58633.1,
910+2dbEST_DT926334.1,dbEST_DT924588.1,
1011+1dbEST_DT926334.1,
1112b+71dbEST_AA413247.1,dbEST_AL034747.1,dbEST_AV270235.1,dbEST_AV368285.1,REF_NM_007661.3,GB_AK077668.1,GB_AK147133.1,GB_AK008283.1,GB_BC052920.1,GB_M58633.1,
12b13+41dbEST_AW210026.1,dbEST_BF607177.1,dbEST_BG969359.1,dbEST_BG298479.1,REF_NM_007661.3,GB_AK077668.1,GB_L37092.1,GB_AK147133.1,GB_BC052920.1,
1314+37dbEST_AA636597.1,dbEST_AW210026.1,dbEST_BF607177.1,dbEST_BG969359.1,REF_NM_007661.3,GB_AK077668.1,GB_L37092.1,GB_AK147133.1,GB_BC052920.1,GB_M58633.1,
1415+23dbEST_AA636597.1,dbEST_AA117324.1,dbEST_AW210026.1,dbEST_BB326705.1,REF_NM_007661.3,GB_AK077668.1,GB_L37092.1,GB_AK147133.1,GB_BC052920.1,
1516+28dbEST_AA636597.1,dbEST_AA117324.1,dbEST_AW210026.1,dbEST_BE448588.1,REF_NM_007661.3,GB_AK077668.1,GB_L37092.1,GB_AK147133.1,GB_BC052920.1,GB_M58633.1,GB_BC025058.1,
1617+27dbEST_AA636597.1,dbEST_AA117324.1,dbEST_BE448588.1,dbEST_BE289998.1,REF_NM_007661.3,GB_AK077668.1,GB_L37092.1,GB_AK147133.1,GB_BC052920.1,GB_M58633.1,GB_BC025058.1,
1718b+33dbEST_AA117324.1,dbEST_AA272653.1,dbEST_AA561075.1,dbEST_AA967253.1,REF_NM_007661.3,GB_AK077668.1,GB_L37092.1,GB_AK147133.1,GB_BC052920.1,GB_M58633.1,GB_BC025058.1,
1718a+2dbEST_AI060852.1,ENSMUST00000143196,
18c19+28dbEST_AA117324.1,dbEST_AA272653.1,dbEST_AA967253.1,dbEST_AV445554.1,REF_NM_007661.3,GB_AK077668.1,GB_L37092.1,GB_AK147133.1,GB_BC052920.1,GB_M58633.1,GB_BC025058.1,
1920+30dbEST_AA117324.1,dbEST_AA272653.1,dbEST_AA967253.1,dbEST_AV445554.1,REF_NM_007661.3,GB_AK077668.1,GB_L37092.1,GB_AK147133.1,GB_BC052920.1,GB_M58633.1,GB_BC025058.1,
2021+33dbEST_AA967253.1,dbEST_AA989746.1,dbEST_AA137828.1,dbEST_AA797580.1,REF_NM_007661.3,GB_AK077668.1,GB_L37092.1,GB_AK147133.1,GB_BC052920.1,GB_M58633.1,GB_BC025058.1,
2122+51dbEST_AA967253.1,dbEST_AA989746.1,dbEST_AA137828.1,dbEST_AA797580.1,REF_NM_007661.3,GB_AK077668.1,GB_L37092.1,GB_AK147133.1,GB_BC052920.1,GB_M58633.1,GB_BC025058.1,
2223+81dbEST_AA989746.1,dbEST_AA797580.1,dbEST_AA562773.1,dbEST_AA244529.1,REF_NM_007661.3,GB_AK077668.1,GB_L37092.1,GB_AK147133.1,GB_BC052920.1,GB_M58633.1,GB_BC025058.1,