NIA Mouse Gene Index (mm92)

Exon structure for U005763

chr5 +

Exon1a 89193972 - 89194245
	CGTCGCGCACGGTCAGTCGCCCGGCTCTCTCAGGGTTCTCCTCACAAGCCCCGCCCCCTACCCTGCGCTCCTGGGACGCCCGGCCCGCCCGGAGGAACCA
	CAGACATGCAGATCCCGCGAGGGCGAGGCGTATAGGGTGGGAGTCGGGGCCGTCAGGGCGGGTTCTCCACGGTCTGCCCAATCGCCTGCGCCTCCGCGCG
	CCAAAGTCAAAGTGCGGGTCCCGCCGGCGCGAGATTGACGCTGCAACCCGGAGCCGCCCGTGCCGCCGTGTCCC
Exon1b 89194246 - 89194371
	TGCAGGTTCCGCACCCGAGCCGTCTGGAGCTAGGCATGGCCACCCCACCTAAGAGGTTCTGCCCTTCTCCCTCGACCAGCTCCGAGGGGACCCGCATCAA
	GAAGATCTCCATCGAGGGGAACATCG
Exon2 89198629 - 89198744
	CTGCTGGGAAGTCAACGTTTGTGAATATCCTAAAGCAAGCCTCTGAGGATTGGGAAGTGGTTCCCGAGCCTGTGGCCAGGTGGTGCAACGTGCAGAGCAC
	TCAAGAGGAATTTGAG
Exon3 89201655 - 89201848
	GAATTGACAACGTCTCAGAAGAGCGGTGGAAATGTTCTTCAAATGATGTATGAGAAACCTGAACGGTGGTCTTTCACCTTCCAGTCATATGCCTGTCTCA
	GCCGGATCCGAGCCCAGCTAGCCTCTCTCAATGGCAAGCTCAAAGATGCAGAGAAACCTGTATTATTTTTTGAAAGATCTGTGTATAGTGACAG
Exon4 89203107 - 89203254
	GTACATTTTCGCTTCTAATTTGTACGAATCTGACTGCATGAATGAAACAGAGTGGACCATATATCAAGACTGGCACGACTGGATGAACAGCCAGTTTGGC
	CAAAGCCTTGAATTGGATGGAATAATCTATCTTCGAGCTACTCCCGAG
Exon5 89205882 - 89205997
	AAATGCTTAAACAGAATATACCTACGGGGAAGAAATGAAGAACAAGGCATTCCTCTTGAATATTTAGAGAAACTTCACTATAAACATGAAAGCTGGCTCC
	TTCATCGGACTCTGAA
Exon6 89207387 - 89207477
	AACCAGCTTTGATTATCTGCAAGAGGTGCCCGTCCTCACACTGGATGTTAATGAAGACTTTAAAGACAAACACGAAAGCCTGGTTGAAAAG
Exon7 89210245 - 89212306
	GTCAAAGAATTTCTGAGTACTTTGTGATTGTACAGGAGCCAGCGGCAATAGAACGTTTCCGGATACTTCCTGCAGTTTTGTGTACTGCCATTGCTTGATA
	TTCATACAAAAGTCTTTACAAGTGTCAAGTTTTTAAACCAGTTTTGTTTTAAGGAAAGCCCTTTTCTTTATGTATACATATATATATAGTTTATTTAATA
	TTTGCAATCATATGTAAAACTTGTGTCCCTCCCGGTCTTCCTTCCACAGTTTTAAATAAACCAGGTGTGAATCTCTTACAGCAGGGAGTCTGGAGGTAGA
	TTTTTCTTAGCATCAGGGCAGTGAGTGGATAAACTGTTCTAACAGGCCAGCCTTCTCTGCCTTCTCACTTGTCATCCTGAGTGGGTTAACATGTTTTCAT
	TGTGTCTTTGCTTCAGAGGTTGACCAATTTCGTCCCGGGACACTTGACCATTCCGTGTAGAGGATGTGTGTCTTCTGTGAGTTGGTATACTTAGGACAGG
	CTGAGAAGTGGGGAGTCCCTGGGAGAGGGATGCTGAAGTGTTTGCTTGGTTTCCTTCCTGGTCCCtttggtagtgttggagattgaagccagggtctctc
	gagctggggaacctctacagaactgtccccagcccTTTTGTTCTAATCAAGTGCCTCTCCTGCTCTACTTAGTGTTGATAAGACCATGTTAGCGTCACCA
	CAGTAATGTTTACTACTGTGTCCGTGCTGTGTTTGTAGAGGAGGAGGCTAAACTCTTCCCAGTTTGGTAATGGTATAATTACTTCATAAATCTTTTCATC
	TTTAATCTGTCTGGGATAAGAACTCTGTATTTATGTGAAATTTTGGACCAGAAGAAATCTTTAAGAGGTAGCTAAGAAGTTTATTACATGAGTATAAAGC
	TTCATTAAGATAGCTACTGCTTTTCTCGGACTACTGCAGTTAAAATGCTTGTTTATGtttctttttttaagacagggtctctctacatacccctagctgt
	cctggaactcaccatgtaggccattctggcctggccttgaactcacagagatccacccacctctgcctccctccccactcccactgctcagataaggtgt
	gcagcatcacgcctgactCGGAGGTTTTTGAAATCACTTGAAGTGCAAGTACAGATTTTTCCATTTTTCTTTTAGTTTCCTAACTAAATTTCTTTTAGTT
	TTCATGTAAAATGAGGATAGAACATGCCAAGGTTTTCCATTTTTCCCCATGGGCCCTGAGTTGATAATGAGTGGTCTCTCTTTAGCTTTGTATGAGGTGA
	GACACTGAGAAGCCTAGGCGGGCTGTTCAGCCCCGCCCAGCCCCGCCTCCATCACCTGGCAGACACTCTCCCTTTTCTGTCTGAAGTTAGAAGGCAGTCT
	GCTGACTTGGGATTTAAGTCACATTTCTGCTGAGAGTGCTGTGGTCACACTGTGCTTCATAGTTTGCTTGCTTTGTAGAATGTTTCTTAACGTTTTTGTA
	GTTAAATACAAATTCCTGATAAAACATTTTTTCATTGCATATATTGTATCATGGGAATGTTACAATTTTGTTGAACTAGGAAATAAAATTAACAAATACC
	AGGAGGCTCAAAGCCCCCATTAATAATGCCCGTTTCTCTAGACAGCTTTCATATTTAGTTGTAAAGTAAGCTTATATATAATTAACAACGTTTTGTTTTT
	TAATTATTGTTTTTTGTCTGCTGTTGTTTTTAAAGTTAAAATGTATATTGTTTTTACCAAGTAGTTGACCTTTCTAATTCATATTAGGAAAAATGTATAA
	TTTCTTGAAACAAAGAATTACATTTGTTTTGAAACTATAATTATTCTTTCTAAAATATTACCTTTTATTTTTGGTTTCTTATTCAAAGATGATAATTGAG
	TGGATTAGCACGGATCTTTGAAAAGATGATTGAATTTCAAGTCTGTAATAACCATAGCTTGTTTTGTGATATTGTTTTTTTGTTGTTGTTGTTGTTTGAT
	ATAAATAAATTTACGAACTTAAATATATATGTCAATAAATGAATTTAAATTTCTTGAACCTT

Links between exon parts

From
exon
To
exon
Splice
sites
SupportExamples
1a1b-4dbEST_BY735651.1,dbEST_BY735577.1,GB_AK145353.1,GB_AK145390.1,
1b2+85dbEST_CA883085.1,dbEST_BU052737.1,dbEST_BQ179293.1,dbEST_BY229464.1,REF_NM_007832.4,GB_BC060062.1,GB_AK145353.1,GB_AK145390.1,GB_BC052004.1,GB_AK048347.1,GB_AK088195.1,GB_AK151851.1,GB_AK004592.1,GB_AK010700.1,GB_X77731.1,
23+85dbEST_CA883085.1,dbEST_BU052737.1,dbEST_BQ179293.1,dbEST_BY735651.1,REF_NM_007832.4,GB_BC060062.1,GB_AK145353.1,GB_AK145390.1,GB_BC052004.1,GB_AK048347.1,GB_AK088195.1,GB_AK151851.1,GB_AK004592.1,GB_AK010700.1,GB_X77731.1,
34+44dbEST_BU052737.1,dbEST_BQ179293.1,dbEST_BY735651.1,dbEST_BY735577.1,REF_NM_007832.4,GB_BC060062.1,GB_AK145353.1,GB_AK145390.1,GB_BC052004.1,GB_AK048347.1,GB_AK088195.1,GB_AK151851.1,GB_AK004592.1,GB_AK010700.1,GB_X77731.1,
45+28dbEST_BU513380.1,dbEST_BY704810.1,dbEST_BU053451.1,dbEST_BF023209.1,REF_NM_007832.4,GB_BC060062.1,GB_AK145353.1,GB_AK145390.1,GB_BC052004.1,GB_AK048347.1,GB_AK088195.1,GB_AK151851.1,GB_AK004592.1,GB_AK010700.1,GB_X77731.1,
56+26dbEST_BY704810.1,dbEST_BQ769231.1,dbEST_CB249395.1,dbEST_BI661617.1,REF_NM_007832.4,GB_BC060062.1,GB_AK145353.1,GB_AK145390.1,GB_BC052004.1,GB_AK048347.1,GB_AK088195.1,GB_AK151851.1,GB_AK004592.1,GB_AK010700.1,GB_X77731.1,
67+25dbEST_BU513380.1,dbEST_BY704810.1,dbEST_BI661617.1,dbEST_CN529509.1,REF_NM_007832.4,GB_BC060062.1,GB_AK145353.1,GB_AK145390.1,GB_BC052004.1,GB_AK048347.1,GB_AK088195.1,GB_AK151851.1,GB_AK004592.1,GB_AK010700.1,GB_X77731.1,