NIA Mouse Gene Index (mm92)

Exon structure for U006096

chr5 +

Exon1a 120120678 - 120120870
	GTAGGCTGAGCTGAGGAGCCGCGGCGAGCTCTCAGGCTGCTGCGAACTCTCTTCTGGATCAGCCACCTAGAGGCGACTTTGGTGAGCGCGCGGCGCCCTG
	GTGGCTCCCCGCCCTCCCCTCTGATCATGTTGACATAAACGCAGGACAGGCCGTAGTACCGCGCGGCGCAGCGACGTTCCAGTTTCCGACACC
Exon1b 120120871 - 120121066
	TTCTTTTTATAACTCGGCTCTATTCCCCCAGCACTCGACCTGTGAAAACCACGCCTATGCAGCCACACAATTGGTCCGAAAGCGTCAAAGAGCCAATCAA
	CAAGCCTCGGGCTCCCGCAGCCCACAGCGCTGCCGGACCGTCCAGAGCCGCCGAGCAGACGCCCGGGGAATTCTAGAGGCGGAGGAGGGTGGCGAG
Exon1c 120121067 - 120121241
	GTGctcgctcgctctctttctctctttctctccctccctctACTTGCCTACTCCAGCTCCCAATCACTCCGTTCTCTTCCTTCTTTCCTATTTTTTTTTT
	TTTGCACCCGTCTTCTTGATCCTCCCTCGCCCTGCGTGCCCGGACGCTGatttttttttaatttattatttttaG
Exon1d 120121242 - 120122413
	GAAAGCGATTTCGCTCACGTTTTTTTAGCACAAGGAAGACAGCCGGCTCCCCGAGGCAGAAGATCGCAGGCACCATTCGCTCGCCACCCAGACTCTGCGC
	GCAGCCCGGAGCCAGAGAGGAGGATCGCGAACCGAAGCCAGCTTCGCAGTTCTAGTTTTGAAAGCGCCGCTGGAAAGGGGCTTAAATCGCtttttttttt
	tttttttttttAAAGGAGAGACTTTTCCTCCCCCCCTTGATCTCGCTGCCTGTGAAAGCCAGAGTCTAGCTCAACTAAGACGCCTCCTGCGAGAAAGCCA
	GAGAAGAGCTAGGGGGCGGGGGAAGGAGTCGAAAAAAAGGTTAAAAAAAAAAGTCTCCGAGAACCTTGCGCTTTGGCAACAAAGAGCGTGGGAGCCGGGG
	AGCCACCCCGGGAAAGGGCTGCAGTGTCTATTTCCAGCTAAGCCACAGGGCTTGGGCGCCAGTCGAGCCCCTGCTTGCTGCTTGCCCTACTGAAACCGAC
	TTCCAGGAGCGGCTTTTCCAACACACTCCACGCACCAGGACAGCCCCTGCAGCGGCTATGTCTCCAGATCTGCTGCCGCTTTGTCCTCTTTAAAAGCGGC
	GTTCTCTTCCCCCCAAAGACACTTTCCCCCTCCCTTTCAAACGCTTTATTTGTAATTTGCCCTCTTTTTTATTTTAAACAAAACTATGCGTCGCTGTTGa
	attttttaattattatttttGAAAAGCAACAACAAAAGCGGAGCCAAGCCAGCAGCTGCGGACTGGTTCCCTGTCTGGAGTGGATGAGCCTCTCCATGAG
	AGATCCGGTTATCCCTGGGACAAGCATGGCCTATCATCCCTTCCTACCTCACCGGGCGCCGGACTTCGCCATGAGCGCGGTACTGGGCCACCAGCCGCCT
	TTCTTCCCCGCGCTAACGCTGCCTCCCAACGGCGCCGCGGCGCTCTCGCTCCCCGGAGCTCTGGCCAAGCCCATCATGGATCAGTTAGTGGGGGCTGCTG
	AGACCGGCATCCCTTTCTCATCCCTGGGACCCCAGGCACATCTGAGGCCTCTGAAGACCATGGAACCCGAAGAAGACGTAGAAGATGACCCTAAGGTGCA
	CCTGGAGGCCAAGGAACTTTGGGACCAGTTTCACAAGCGGGGTACAGAGATGGTCATCACGAAGTCAGGAAG
Exon2 120124035 - 120124302
	GCGAATGTTCCCTCCGTTTAAAGTGAGGTGCTCTGGACTGGATAAAAAGGCCAAGTATATTTTATTGATGGACATTATAGCTGCTGACGACTGTCGATAT
	AAATTTCACAACTCTCGGTGGATGGTGGCCGGTAAGGCAGACCCCGAAATGCCAAAGAGAATGTATATACACCCGGACAGCCCCGCTACGGGGGAGCAAT
	GGATGTCCAAAGTCGTCACTTTCCACAAACTGAAACTCACCAACAACATATCGGATAAACACGGATTT
Exon3 120125252 - 120125311
	ACTTTGGCCTTCCCAAGCGATCACGCAACGTGGCAGGGGAATTATAGTTTTGGGACCCAG
Exon4 120125567 - 120125713
	ACTATACTAAACTCTATGCATAAGTACCAGCCGCGGTTCCACATCGTCAGAGCCAACGATATCCTGAAACTGCCTTACAGTACTTTTCGAACCTACCTGT
	TCCCGGAAACAGAATTCATCGCCGTTACTGCCTATCAGAATGACAAG
Exon5 120127510 - 120127586
	ATAACTCAGTTAAAAATAGACAACAATCCCTTTGCAAAGGGTTTTCGAGACACTGGCAATGGCAGGAGAGAAAAAAG
Exon6 120128690 - 120128841
	AAAGCAGCTCACACTGCAGTCCATGAGAGTGTTTGAGGAGAGGCATAAGAAGGAGACTTCGGATGAGTCCTCCAGCGAGCAGGCAGCCTTCAACTGCTTT
	GCCCAGGCATCCTCTCCTGCTGTCTCCATCGTGGGGACATCCAACCTCAAAG
Exon7 120130404 - 120131074
	ATCTGTGTCCCAGCGAAGCCGAGAGTGACGCCGAGGCTGAGAGCAAGGAGGAGCACGGCCCTGAGGCCTGCGACGCGGCCAAGATTTCCACCACTACGGC
	CGAGGAGCCAGGCCGCGACAAGGGCAGCCCAGCAACCAGGGCGCAGCTGTTCCCCGCGGAGCCCAGCCGGGCCCGCGACACCGCGCGTCTGGACAAGGCA
	TCGCCAGACTCGCGCCATAGCCCGGCCACCATCTCGTCCAGCACGCGAGTTCCGGGAGCTGATGAGCGCAGGAGTCCCGGGCGCGAGGGTCCAGTCGCCA
	CCAAGGTGGATGAGGCGCGCGCGATTCCTGCCAAGGACGCCTTCGCTCCACTGTCGGTGCAGACAGACGCCACCGCGCACCTAGCGCAGGGGCCCCTCCC
	GGGCTTGGGTTTCGCCCCAGGCCTTGCGGGCCAGCAGTTCTTCAACGGGCACCCGCTCTTCCTGCACCCGGGCCAGTTCGCCATGGGCGGCGCCTTCTCT
	AGCATGGCTGCAGGCATGGGGCCCCTGCTGGCCACAGTATCCGGAGCATCCACCGGCGTCTCAGGCCTAGAATCCACAGCCATGGCCTCGGCTGCCGCAG
	CGCAGGGACTGTCTGGGGCGTCGGCTGCCACCCTGCCCTTCCACCTCCAACAACACGTTCTGGCCTCCCAG
Exon8 120132640 - 120134733
	GGCTTGGCTATGTCGCCTTTCGGGAGCCTGTTTCCTTACCCCTACACATACATGGCTGCAGCAGCTGCAGCCTCCACCGCGGCCGCCTCCAGCTCCGTGC
	ACCGCCACCCGTTCCTCAATTTGAACAGCATGCGCCCCAGGCTGCGTTACAGCCCCTATTCCATCCCCGTCCCAGTGCCGGATAGCAGCAGTTTGCTGGC
	CACAGCTTTACCATCAATGGCTTCCGCCGCGGGGCCCCTAGACGGCAAAGCGGCCGCCCTGGCAGCCAGCCCAGCCTCGGTGGCTGTGGACTCGGGGTCG
	GAACTGAACAGCCGCTCGTCCACGCTGTCCTCTGGCTCAGTGTCCTTGTCACCCAAACTCTGCTCCGAGAAGGAGGCGGCTACCAGCGAACTGCAGAGTA
	TCCAGCGGCTGGTCAGTGGCTTGGAAGCCAAGCCAGACAGGTCTTGCAGCGGGTCCCCTTAAAAACAAGAAAAACAAAATCGCCCCCTCCCCCAAGGTCT
	CTCCATTCCAGTTTGGTCAAATCTGCCAGTGCACTTTGTTAGATGTAAAATAAACCACGGGCCTTCCACATGGGGTGACCCCCGCCCTGTCCCTTTCAGT
	TTTGTCTGGGAGGGAGCACTAAAGCCTTTCCAGAGACTATGCTAGATACCACAGGCCCTGCCACCATGGGCTGTGTAACCAGGCTGCTGTTGCTTTGAAA
	CGCGGGACTGAGGGGGCGGGAGGAGTGGTGGCAAACAGGCTTTTGTGTCTAGAGCGACTTTTGTGCAGGCTGGTATGGAAGTCGGGGCTGAAGAACAAGG
	TAGCCAGGCCAGCCAGGAGCGCGGGTCTTTGAGAGACTTCACCGGAATCTTTCCCCCTTCGTGTGTTTAGTGGAAACATCCCCCCTCCTAAACAAACTAA
	CAAAACCAATATGGAGGTGGGGGGAGATGAAGTCCTGTGGAACTGTCTATGAAGACTGAAACTCACCAATTGCTGAGTACTTTCGTTGGGGCAGAGAGAA
	GAGGGGCCTTACCTTGCCCCATCTATATTAAAGGAATCCTGTCTTTTTTTGTTTGTTTGTTTTTAAATATTGTGATGTTTTAAGAGCCGATGCTGGCTTC
	TTTTTTGCATGTTACAGTTTTCTGGGTTTATTTTGCCCCCCCCCCCTTTTATGGAAAAACAACGGAAGTCCCATTATCCTCAACCTTGCTCAAGGCGGCA
	ACCAGGAGGAAGTGGGGTAAAAGGGGCAGCTATGGGCATGAAACCAACCGAGTTGATTTTTATCTGAGCGCTTGTAGAGGGCTTCGTGTGCCTGTTGGAC
	CATTAGTTCTTTTAACTGTATATGCAATAACAAGGTTTTAAAAGATAATAATAAAGAGGAAACACGACTATTGGACAAAGTATTTATGTAATTATTTGAT
	ATCTCTTGTAAATAGGTGGAATATGACTGCTCAGAAAGTTAAACTTTAATTTATTGAATTGTACATAGCTGGATGTAAATAGGAGCGTGTCTGTCAGGTT
	TTATTCTTGTTTTGCCTTTTGGGTCTTATTTCCAGGTCAGGAGATGGCTAATCCACACTAGCAAGCCTAGGCATCTTTATTCACATCTCCATGCTTTCAA
	GTAGAGCTGGCTGCAAAGTTTTTTTTTTTTTTTCTGATGGAGGGGGTGGGATCGGGAGTACTCCTAACTATTTTCACCAAAATTGGGGAGGTAATGGCCC
	TTCCGGGCTCCACTTGAAATTCCCTAAACTCTTGACACCCCCAGAGGGGTTGAGATTGTTGTGTGAGTAGGGGGGGGGGGGGAACGGCCTTGCGGAGGCC
	ACCATAGAACCGTCCTAATTTTTCATAGACTCTGGCATCTTACTAACCCATGTGAGGTTTTCATTGTTCATCTTTATGGTGTTTTGGATTGGTGTACTGA
	GAGGGACTTGGTTCAAACGACCATGAAAGGCaaaacaaaacaaaaaattaaaaaaaaaaacaaaaaacaacaacaaaaaaacaaaaaaaaaaCCCAAGAA
	GGAGTATTTTGTGTTTAGTCTTTGATGAGTTTTCTGTAATTCTCCCCCTCTTTAAAAACATCACTGAAATTTCAATAAATTTTTATTGAAATGA

Links between exon parts

From
exon
To
exon
Splice
sites
SupportExamples
1b1d+5dbEST_CF726374.1,dbEST_CJ079548.1,dbEST_CJ080780.1,ENSMUST00000121021,GB_BC096551.1,
1d2+17dbEST_BF538993.1,dbEST_CF900412.1,dbEST_CF899292.1,ENSMUST00000121021,REF_NM_011535.2,REF_NM_198052.1,GB_BC096551.1,GB_AK052453.1,GB_AK145436.1,GB_AK157247.1,GB_AK172118.1,GB_U57328.1,GB_AF429310.1,
24+9ENSMUST00000121021,ENSMUST00000079719,REF_NM_198052.1,GB_BC096551.1,GB_AK157247.1,GB_AK172118.1,GB_U57328.1,GB_AF429310.1,GB_U15567.1,
23+8dbEST_CF900928.1,dbEST_CF901092.1,ENSMUST00000018748,REF_NM_011535.2,GB_AK052453.1,GB_AK145436.1,
34+9dbEST_CF900928.1,dbEST_CF901092.1,dbEST_AV512473.1,ENSMUST00000018748,REF_NM_011535.2,GB_AK052453.1,GB_AK145436.1,
45+22dbEST_CF900928.1,dbEST_CF901092.1,dbEST_AV512473.1,dbEST_BQ573628.1,REF_NM_011535.2,REF_NM_198052.1,GB_BC096551.1,GB_AK052453.1,GB_AK145436.1,GB_AK157247.1,GB_AK172118.1,GB_U57328.1,GB_AF429310.1,
56+22dbEST_CF900928.1,dbEST_CF901092.1,dbEST_AV512473.1,dbEST_BQ573628.1,REF_NM_011535.2,REF_NM_198052.1,GB_BC096551.1,GB_AK052453.1,GB_AK145436.1,GB_AK157247.1,GB_AK172118.1,
67+18dbEST_CF900928.1,dbEST_CF901092.1,dbEST_BQ573628.1,dbEST_BE647536.1,REF_NM_011535.2,REF_NM_198052.1,GB_BC096551.1,GB_AK052453.1,GB_AK145436.1,GB_AK157247.1,GB_AK172118.1,
78+24dbEST_CF900412.1,dbEST_CF899292.1,dbEST_AW049527.1,dbEST_BB664187.1,REF_NM_011535.2,REF_NM_198052.1,GB_BC096551.1,GB_AK052453.1,GB_AK145436.1,GB_AK157247.1,GB_AK172118.1,GB_AK087128.1,