NIA Mouse Gene Index (mm92)

Exon structure for U006275

chr5 +

Exon1 135499352 - 135499480
	GGGGCGGGGCGCGGGCTGGCGCTGCGCAGCCGCGGGGCGGCATCCGCGCATGCGGGACTTACTCGGTTGCAGCCGGCGCCTACTGCCACTCCCGGGAGCA
	TGAAGGACCGAACCCAGGAGCTCCGCACG
Exon2 135512996 - 135513073
	GCCAAGGACAGCGATGACGACGACGATGTCACTGTCACTGTGGACCGAGACCGCTTCATGGATGAATTCTTTGAACAG
Exon3 135513346 - 135513445
	GTGGAAGAGATCCGGGGCTTTATTGACAAGATTGCCGAAAACGTGGAGGAGGTGAAGCGGAAACACAGCGCCATCCTGGCCTCCCCGAACCCCGATGAGA
Exon4 135517107 - 135517181
	AGACAAAGGAGGAACTGGAGGAGCTCATGTCGGACATTAAGAAGACAGCGAACAAAGTTCGCTCCAAGCTAAAGA
Exon5 135517801 - 135517874
	GCATTGAGCAGAGCATCGAGCAGGAGGAAGGTCTGAACCGCTCATCAGCCGACCTGAGGATCCGGAAGACGCAG
Exon6 135517979 - 135518087
	CACTCCACGCTGTCCCGAAAGTTTGTGGAGGTCATGTCCGAGTACAACGCCACTCAGTCAGACTACCGAGAACGCTGCAAAGGGCGCATCCAGAGGCAGC
	TGGAGATCA
Exon7 135518463 - 135518536
	CCGGCCGGACCACGACCAGTGAGGAATTGGAAGACATGCTGGAGAGTGGGAACCCTGCCATCTTTGCCTCTGGG
Exon8a 135521467 - 135521604
	ATCATCATGGACTCCAGCATCTCGAAGCAGGCCCTCAGTGAGATCGAGACCAGACACAGTGAGATCATCAAGCTGGAGACCAGCATCCGGGAGCTGCACG
	ACATGTTCATGGACATGGCCATGCTGGTGGAGAGCCAG
Exon8b 135521605 - 135521728
	GTGAGTCCCCTCGTCACCGGCATCCGGCGGCTCTGGCCCCCAGCCAGCAGCATCCAGGGCCACACTAACCCCTTCCCTTTCCACCCAACACGCTGCGTGC
	CCGGGAGGGACAGAGTATCTTCAG
Exon9 135523412 - 135523528
	GCATCTCACctgctggaccttgcctctcgttcccacatgatgggctcacaggcctatatgcctgtattcagtggacacagtgctggagatcaaacgtggg
	ccctcccgcatcctaga
Exon10 135524581 - 135524700
	GGTCACAGCTGGCCACCCTCTGCATGGTCCTCAACCTTGTCTGAGACTGCATGGCCAATGCCACACCCCGGGATGGCTGCTGTTTGGGACCGGTGGGAGC
	TGCCCCTAGCTGTCTTGTCC
Exon11a 135524781 - 135524863
	GAGACTTTCCTGAACCCCTACCCTGCACTCCCTCCTGGTCCTGAGGAGGGACGCCTGGACCTTGGGTACCCCCGGTCCTGCAG
Exon11b 135524864 - 135524974
	GGGGAGATGATTGACAGGATCGAGTACAATGTGGAGCACGCCGTGGACTACGTGGAGAGGGCCGTGTCAGACACCAAGAAGGCCGTCAAGTACCAGAGCA
	AGGCGCGCAGG
Exon12 135525697 - 135526973
	AAGAAGATCATGATCATCATTTGCTGTGTGATTCTGGGCATCATCATCGCCTCCACCATCGGGGGCATCTTTGGATAGAAACCACCCCACCCACTGCTCC
	ATTCTGGATGGGTCTCCCTGAGGAGGCCCCTGGCTGCTGCACCTAGCTGGGTTGCCCTCCCCACTCCTGCCTTCTGGCTGGGAGTCCTTTTCCCTCCCAT
	CCCACACTGCTCCCTCTCTGCCATGAGGCTCCCGTCCCCACCACCCTGCCCCAAGCCGTGTCGTGTGCATGATCTTGTGACAGTGTGTGTCTGTACAGGA
	GGCAGAGTCGGGAGCAGGATTGGGAACAGCCAGAGTGGCTGGGTACAGGCCAGTGCGGGGCAAGACTCGGGCCCTGGCCAGGTCTGCCTTTCTTCAGCCT
	GGGGTCTACACTTCCCTGGGACTCAGGCTCCTTTCTGGACCCCAACCTTGCCCTCACTTGTCCCGTCCTCTGGCTTCTCCAGCTCTTCCCACCATGCCAA
	GGCACCTGGAAGGTGGGGACCAGCTGGTCACATGGTGCTGCTTTTCAGGTTAGGGGTGGGGATAGCTCAGCACTGAGTCTTTGTTAGCTGCCCCTTGCCC
	GGAGGCTCAGGGTGCCACGGCTGCGGGTGTTAGGAGCACCTAGTACCCTCTCTTTGGGCAAAGCCTGACAGTGTCTCTGGCCCTGGGAGTCATGTTCCTG
	GGCTGGGCCTGAGCCTAGTGACCCTTTACTAAGAAGCTTAGTGGTGTCATCTCCAGCCTTGCTTTGAGTTGGAGGGATGGAGCAGGCCATAGTCCTAACA
	GGCATGGTAAGTTGTGGCCAGAGTTGCATGTTGGGGACAGCAGTTCCCTGCGCCCTTTATGCTCTGAAAGCCAGGTGTCACTTTGGGCCTGTAGTCTCAC
	CCTGCCCCGTCTCCCATTGATGTGCCACGTGGTATCAGGTGTACTGGATGCAGTATTCAGCAGCCAGCTGGGGAGGGGGCTCCCCACTTCCCCCCTTGCC
	ATCTTGGGGCTTCTCAGAGTCAAAACTGTACCCCCTGCCCCAGGACCCCTTTCTCGCCCACAGGCAAGGAGTATGCATGCGAGTGCATGCAGCGGGAGCT
	GGGGCCGTGTCTGTGTGCCCCCTTTCCCTCAGCTTTGCTCCTGCCCAGTGACTGTGACCACTGTCCGTGCTGCCTTCTCACGGCCACCTCCCTTTACCCC
	TTCACCAAAGGTCTTGGTACAACCAGCTGCCCATTTTGTGAGATTTTTATGTAGAATAAACATTTGTATCTGTAGTG

Links between exon parts

From
exon
To
exon
Splice
sites
SupportExamples
12+65dbEST_BY240737.1,dbEST_BY291883.1,dbEST_BY287672.1,dbEST_BY289537.1,REF_NM_016801.3,GB_BC100446.1,GB_BC057892.1,GB_D45208.2,GB_BC047133.1,
23+69dbEST_BY240737.1,dbEST_BY291883.1,dbEST_BY287672.1,dbEST_BY289537.1,REF_NM_016801.3,GB_BC100446.1,GB_BC057892.1,GB_D45208.2,GB_BC047133.1,
34+65dbEST_BY240737.1,dbEST_BY287672.1,dbEST_BY289537.1,dbEST_BY286144.1,REF_NM_016801.3,GB_BC100446.1,GB_BC057892.1,GB_D45208.2,GB_BC047133.1,
35+2dbEST_BY291883.1,dbEST_BY254453.1,
45+73dbEST_BY240737.1,dbEST_BY287672.1,dbEST_BY289537.1,dbEST_BY286144.1,REF_NM_016801.3,GB_BC100446.1,GB_BC057892.1,GB_D45208.2,GB_BC047133.1,GB_AK144399.1,
56+57dbEST_BY291883.1,dbEST_BY289537.1,dbEST_BY272343.1,dbEST_BY259095.1,REF_NM_016801.3,GB_BC100446.1,GB_BC057892.1,GB_D45208.2,GB_BC047133.1,GB_AK144399.1,
67+27dbEST_BU848304.1,dbEST_BI655470.1,dbEST_BG974180.1,dbEST_BY725109.1,REF_NM_016801.3,GB_BC100446.1,GB_BC057892.1,GB_D45208.2,GB_BC047133.1,GB_AK144399.1,
78a+24dbEST_BI655470.1,dbEST_BG974180.1,dbEST_BB648021.1,dbEST_BQ715840.1,REF_NM_016801.3,GB_BC100446.1,GB_BC057892.1,GB_D45208.2,GB_BC047133.1,GB_AK144399.1,
8a11a+10dbEST_CJ069935.1,dbEST_BF118920.1,dbEST_BF118947.1,dbEST_CK794836.1,GB_BC057892.1,GB_AK144399.1,
8a11b+9dbEST_BQ715840.1,dbEST_BU054848.1,dbEST_BU057334.1,dbEST_CD364178.1,REF_NM_016801.3,GB_BC100446.1,GB_D45208.2,GB_BC047133.1,
8a9+1dbEST_CX200829.1,
8a10+3dbEST_CN709169.1,ENSMUST00000133812,NIA_E0557D07-5,
8b11a+1ENSMUST00000144198,
11b12+17dbEST_BU057334.1,dbEST_CD364178.1,dbEST_BF118920.1,dbEST_BF118947.1,REF_NM_016801.3,GB_BC100446.1,GB_BC057892.1,GB_D45208.2,GB_BC047133.1,GB_AK144399.1,GB_BC023379.1,