NIA Mouse Gene Index (mm92)

Exon structure for U007074

chr6 +

Exon1 83051510 - 83052632
	GAGTAAGTGGGTGGCCATCTTTGTTAGGGGCAGAGGTCGTGGCTACGGAGCCCCAGTAAGACCACGAGACTTCCGGCTAGCTGGTGAGTCCTGGCGCCCA
	CGGGCGTGGAGTGCGACGGGAAGCGGGGAGGCGGCGAGCGTTAGGTTCGTTTGGGACTCGCCGTGCAAATGGCACGGGCGTCCAGCTCTAGTGGCCCTTT
	GCCTCCACTCGCTAACGTACCCTCGTCGTGGGCGCAGCCCGTGGGCGCTGGGGAGGAGCGGGACGAGGGGAGGCGTGGAGGGCTAGGGCTACTGGCTGCG
	GTGAGCGTCCCGTGCCCGGACTTCAGCAGACAGCCGTGGGCTCCCGCGTCTGCAAGCGGCCCGATGCCCTTCGCTCTTCAGCGGCTCCGGGCCACATTGC
	TTCGTCTGCACCGCGAGCGAGAGCAGCTCCTGCGGGCCCGGGACTGCGCCCGCCACCTGCAGGCGGTCGTGCGGCTGCTCCGCTCCGGCTCCTCGGCCGG
	TTCCCTCTCCCTGCAGCAGTTGCACGGCGATTTACAGCTGTGCCCATCTCGTGGGGCGGCTCTGCGCCTCGGCTTCCCGGGCTCCAGGGAGACGCTTCTC
	CTGACTCGCCCTGTCGGGCTAGCTGCCCAGCACTTGGAGGCTGCCATCGAGATGCAGCTTCGTTCACTGGGCCGGACACCCGCTAGCCTGGGCCTGACAT
	CCCAGCTAGCCGAACTGTTGCTGGCCCTTCCCTTCTACCACACTCTGCAGGGACATTCCCTGAACTTCGTCCCCGGGGCCGCGCGCCCATTCCCCGCGGC
	CCGTGTGCTCCAGCTCCTGGCTGCAGAGCGGGGTTGTCAGGTGGCAGATAAGCTGGCTGAAGCCCGTGGCGGATCGGGCTTGCAGGAGCAGCTCCGTCGG
	CAGTGCGAGCAAGAGCGAGAGCTGCTGCCCGGGCTGCTGGGCCTGGTAGGGGGCGTGGCTAGCACCGACAGCAGCGGACTGAGGCTTGGGGGACCTGGAG
	CCCTGTGGAGCCAGTATTGGACCTTGCTGTGGGCAGCCTGTGCTAAGTGTTTGGACCTACGCGTGGGACCCTGGGAGGACCCTAGAGCAATGGCACAAGA
	GCTGAGTCAGGCACTGTGTCAAG
Exon2 83052952 - 83053038
	CACCCCTGCCTCAGGAGTGTGAGAAGGAGCTGTTGTCTCTGTGTCACAGCCTGTTTCACCAGTCTGTCATCTGCAGCTGGGACCAAG
Exon3 83053114 - 83053263
	GGTTCTGCCAGGCCTTAGGATCAGCCCTGGGTGGTCAGAGCAGCCCTGCGTCACTGTCTCCTACCTCTGAGCTGCTGCAGCGGCTTTTTCCTCCCCTCTT
	GGATAGCCTTCGACAGCCCAGGCCAGAACTTAGGCTGTGTCCGCCTGCAG
Exon4 83053396 - 83053526
	GTCCTACGCCTGTCGCTCTGGGGCTCTGTACCCTGCAGACCACCTTGCTCTGGTTTGTGGGCAGAGCTCAGCAGCACCTGGCAGCGTGGGACCCCGGTTC
	CTTCTTGCTCCTGCTCCAGAAGGATCTGCCT
Exon5 83053606 - 83053719
	CCTCTTCTGTCTGCGGTGGAGGCGCTGTCCAGCCTGGCCTCCGAAGCAGCGCTCACTCTGGAGGTGGAGCAGCAGCTGGGCCTAGAGATCCACAATTTGA
	CTGAAAAGATGCAG
Exon6 83057047 - 83057161
	CTCCTGCCCAAAGAATCACTGGGTCTGTTTGTCCAAGAATGCCATAAACAAGCCACACAAGGCTTCAAGCTCCACATGCCGAGGGGTCGATACTGGAGAC
	TTCGATTGTGTCCTG
Exon7 83057449 - 83057626
	AACCTCCCAGTGACCCTAGTGAGTACGCTCGGATAGTGGTCTACTCTGTGTTGGAGCCTGTGTTGCAAGGACTTCAGGGATTGCCACCTGAAGCCCAAGC
	CCCTGCCCTCGGCCAGGCACTGACAGCCACACTGGGCGCCTGGCTTGACCACATCCTCACCCATGGGATCCGGTTCAG
Exon8 83057749 - 83057948
	CCTGCAGGGGGCGCTGCAGCTCAAGCAAGACTTCGGAGTGGTCAGGGAGGTTCTGGAACAAGAGCAGTGGGGCCTGTCGCAGGAGCTTCGCCAGACTCTG
	CTCTCACTCAGCATCTTCCAGCAGCTAGATGGGGCCCTGCTGTGTCTCCTGCAGCAACCCCTGCCCAAGAATCCAGTCCACAGAAGACCTCCCCGTTGCT
Exon9 83058085 - 83059197
	GTCTCTGTTATGAGGTCCAGACCACTGAACTGCCCACCAGCAGCCTCAACAGCCTGGAAAACTTGGCACCCCCTCTTCGTCTTGGAGTCTCCCCTGCCCA
	GAACACTCACCTGCTAAGCACCCTGgggggaggaggacgaggaggagggggagggggaggaCCAGGACCTAGTCCTGAGGCTTACCTGGTGGGAAACCAG
	CAAGCCTGGCTTGCCCTGAGGCTGCACCAACACCCACGTTGGCACCTGCCTTTTTTTTCTTGCCTGAGGACAAGTCCTGAACCCTAAGTTGACTAGGACC
	AGGGGTTGCAGATCATGCCCCAGACAAGGAACTGTATGCTAGAGAAGCTTAAACCTGGGTGCTTGATAAAACATGTTCATAAACTAGAGTCCAGAATTGA
	ACCCCCAGATCATCCTAGGATCTGCAATCCAGAGTAATAGGCAAACTACAGCCTGAAATCTGGATGTCGGAAACAATGAAGACATCTTGGAGCTAAAACT
	AGAAGGGGTCTACAGGGCTAGCGCTCAGGAGACAGGCAAACCTTGCTTTCTCTCGAATCCCAGGAGCAAAGCGAAAACTGATTCATGAGGAAACACAGAC
	AAAGCAGACATTTCTACACGTGGAGGGCAGTCTTACCCCTTCCCCGTCTCTGTTTCTAGTCATTAGGCTGTAGGGCCTGGACATTTAAGCCTTGGCTGTT
	GCTACAGGGGCAGGGCTTGCCTTCTGCTGGGTGGACAGTCCCCGCAGTGACATCCTTTCCAAGGAAGGAGCCAGGATGTGGGGTGGTGCTGACCTAGATC
	TCGCAGGCAGGACCCCGAGGGAGAGGGCTGAAGGACGTTTTCCTGCGAAGGGGATTTTGCACATTCACTGCTTATGCTGTGTGGCACAGAACACTGCTAA
	TGGCTGAAGTATTCGCGGGTGGCCCCGGAGGTCAGCCGCGCGAAGTACCGCGGAGCCGCCGGAAGCGGTCCGTTCCAATAAACCGATCCCCAGTGCTACT
	CCTTCCGGGGTGGAGGTAACCATGGCGGCGGCTTTGGCTCGGCTCGGACTACGGCCGGTCAAGCTGGTTCGAGTTCAGTTCTGCCCGTTTGAGAAGAACG
	TGGAGTCCACGAG
Exon10 83059308 - 83059420
	GACCTTCCTCCAGACGGTGAGCAGCGAGAAAGTCCGCGCCACCAACCTCAACTGCTCTGTGATCGCCGACGTGAGGCACGACGGCTCTGAGCCCTGCGTG
	GACGTGTTGTTCG
Exon11a 83059516 - 83059780
	GAGATGGGTATCGGCTGATTATGCGCGGTGCCCACCTCACCACTCAGGAAATGTTAAGTGCCTTGGCCTCCCACATCCGGGACAGGAACGCCGCGGCAGC
	ATCTGCACCGGGCGCAGACAAGGTCGCCCCGGGTACGAGTACCCGCCGCTGATATGGCAGAAGAGTCCAACAACCAAATGTTAGCTTGAATCTAAAGACA
	GTGAGTGGTCTGAGAAGACCTGGGCTTTAATCACTCAAAATGCTGCATGGAGCTCATGATACGGA
Exon11b 83059781 - 83059933
	GCAAGAACACTAACAACAGGGCTTCTGGGGCAAGATAAGTAAGTTTGGGTGGTGAAGGGCCCCGACAAATTGGAATTTTTCTTTCTCAGTGTTTAACTTT
	ATTTGGATCTGTCAACCAAGTACATTTTAATTAAATATTTATTGCCAAATGAA

Links between exon parts

From
exon
To
exon
Splice
sites
SupportExamples
12+5dbEST_BG972618.1,dbEST_BF538607.1,ENSMUST00000101254,ENSMUST00000101253,REF_NM_001081266.1,
23+4dbEST_BF538607.1,ENSMUST00000101254,ENSMUST00000101253,REF_NM_001081266.1,
34+5dbEST_BG972618.1,dbEST_BF538607.1,ENSMUST00000101254,ENSMUST00000101253,REF_NM_001081266.1,
45+5dbEST_BG972618.1,dbEST_BF538607.1,ENSMUST00000101254,ENSMUST00000101253,REF_NM_001081266.1,
56+6dbEST_BG972618.1,dbEST_BF538607.1,ENSMUST00000101254,ENSMUST00000101253,REF_NM_001081266.1,GB_AK217537.1,
67+6dbEST_AW762209.1,ENSMUST00000101254,ENSMUST00000101253,ENSMUST00000134891,REF_NM_001081266.1,GB_AK217537.1,
78+3ENSMUST00000101254,ENSMUST00000101253,REF_NM_001081266.1,
89+3ENSMUST00000101254,ENSMUST00000101253,REF_NM_001081266.1,
910+86dbEST_CO043042.1,dbEST_CA468051.1,dbEST_BY097528.1,dbEST_BY094851.1,REF_NM_026744.3,GB_BC065995.1,GB_BC022162.1,GB_AK003549.1,
1011a+112dbEST_CO043042.1,dbEST_CA468051.1,dbEST_BY097528.1,dbEST_BY094851.1,REF_NM_026744.3,GB_BC065995.1,GB_BC022162.1,GB_AK003549.1,
11a1-1dbEST_CF983362.1,