NIA Mouse Gene Index (mm92)

Exon structure for U007511

chr6 +

Exon1 139535742 - 139535786
	ATTCCTGATGGCGGAGGAGGAAAAGACGGAGCGAAACACATGAAG
Exon2 139537019 - 139537254
	CTTACATAAACCAGTCAGAACGAAGCGAATTGAAAGCGAAGCACAGCAAATCCTAACGACAGACACGTGGGCGTTTCCAGAGCGAGGCAGTGGTATGACT
	GCCCTTAGGGCAGGTTAGCAATGAGCCATGACTAAACGGATGGACCAGGGTAAAGAGCAAACTACGCCACTGTAGGCCCGGAAGGCAAGAGGTCAGCTAA
	CGTGAATCTGTGCGGGGTGAGCTCTCTGACAGACAG
Exon3 139548001 - 139548077
	GTTAGACCTGTGTTCTCTTCCATGAGTCCTGAAGAGAAGTGAGATCATGTGCAACTTCAGAGAGAGATTTACTTCAG
Exon4 139564836 - 139564907
	GTCTTTCCAGAAGCCGTGTTATCTGTGATGGGTACATTTTCTGCATCGTTCGGAAAATACAGAAGGATTAGT
Exon5 139566424 - 139566681
	ttgctgtgttaagtctcacagatggccatttaggaataaagcattggttttagctcacagttcaaagcagagtccatcatgattgggagctgaggcaact
	cggccacaccccttccacaagcaacaatggaaggatacataaatggattctgcttcttggatccttttctccaattctccaaagttcaataataatccat
	ttatggaatggagccacccacggtaggcgggaggtcctcatcaattagcacaaccaag
Exon6 139570333 - 139571086
	GAAAATTTAGAATTTCTTTTATAATATCAAGAAGACATTTGGAGCCAAATAAATCCTCTGTTACACAAAATCAAAAATGGCATACAGTTGGCAAACAGAG
	CCAAATCGCACTGAACCACAGGAAGATGGATCTGATACCCAACAATTTCACCATACAAACCAGCACCTTTCTTCCAGTCAAGTCAGGTTGGGTTTTGATC
	AGCTGGTGGAAGAGATCAATAATAAGACTCCACTGTCTGAGAGTGAAAAGGAAGAAGACACGTATTTTGTGCCAGATGCACCAAACTTGGGTTCAAAATG
	GCCATCCATATATGAAACACACCCAAGATACTTCAGTGAATTCACTTCTCAGAGCCCTGACTCCTCCCAGCTTCGGTTTGGAAAACTATCAGCCATTGGT
	TTTAATCCTGCTGTACTACCAACCCATCAGCTCATTCATGAGGGAGCTTCCTGGAGAAATCCCAGTGGAAAATATCATGGCATCGAGTATCCCAGATTCG
	ATGCTCTACCTCCATCATCCACTGGCCAGGGTGAGTGTAATCCACAAGGACAATCAGGAACCAAACATCATAACTACTGTGGAGAACATGAAGGCAATCT
	CCCCCATCATCATTCATCCTACTCAATAGACTCCATACCGAATAGAGAGAAAAGAAGGAGTGGAGATGTGAACCTTGTAGAACCTTCTCTGGAGTTCTCT
	AAAGACTCCTTTCTACCCAGGACATCGGAGAACGTGTCAGTGGAAAGCACAGAG
Exon7 139575017 - 139575099
	CCGATTGGTTGTCCCATTGAAATAGTTGAGGTACCCCAAGGGAGTAACAAGAACCTGGCCTCCTTTTGTAACAAAGTAAAAAA
Exon8 139578239 - 139578396
	GATAAGAGAATCGTACCATGCAAGTGACATTAATTCCAATTCTGGGAAGATCTGGGCCATCACCACAGCCTATCCATCTCGGCTCTTCGCTGACACCAAA
	TTCAGAGTAAAAATTTCTATTGATAACTCAGCCCAACTCCTCCTTCTTATGCCACACG
Exon9 139582198 - 139582312
	CTAATTATCTTGTCAAAGACCTAATTGCTGAAATTCTACTTTTATGTGCAAATGAGCCGCTTTCCCCCAAAGAGTATCTTCTAAGTGTATGCGGTTCTGA
	GGAATTTTTACAGAT
Exon10 139584090 - 139584595
	CATTaactaccctgagctactacctcccaccagtctggatgacaatcatcaagaaatcaaacaacaaatgttagagaggaagtggagaggattattattc
	cttactccttattcactgctggcgagagtgcaagttaatgcagacgttgtggaaggcagtgtgaagacttaaaatacttcaaaagaaaattaccatatga
	cccattaatttcactcctgggaatataactggagaatgtcatagcctaccacagacatatatgaacctccatgtttattatcatcaactatagaaatcaa
	tttaaatcaaccaaattgtatatcagcagataaataaataatgattttgttttgtgtgtgcacacgcacacacacacacatatataaaacctatatatga
	ctactattcagcactaaagaaaaatgtgatcacaaactctgcaggaaaatgtatggacttagaataaaatgataCATTTAATGACCTTTTAAATAAATAG
	TGCACT
Exon11 139597650 - 139597752
	GGATCACTCTCTAGGGGGCCACAAAATATTCCAGAAAAATAAATCTGTCATTCAACTTCATCTTCAGAAAAACAGGGACACTCCAGGAAAATTATCCCGG
	AAG
Exon12 139605682 - 139605752
	AGTGAAGATGACCACAGTCCGTTTCATCTGAACCAACTTCTAGAATTTACACATATCTGGAAAATATCCAG
Exon13 139610927 - 139610979
	AAGTTTCTGGAAAGAAGTACCCACCGTCTGCACTCTGTCTAGGGATCATGTAT
Exon14 139611118 - 139611170
	ACATGCCCTTTGTgcccacaagatggctccacctgtcaccggtaaatgcatct
Exon15 139664088 - 139664105
	CTTGACAAGGTCTGCAGG
Exon16 139664382 - 139664415
	AATTTTCATCAGAATTCAGAGACTTCAAAAAAAG
Exon17 139668510 - 139668705
	GCTTCATAGAGAGAGTGACAGCTGAACTATCAAGGTCCATCTATCAGCTAATCGACGTGTACTGCAGTACCTTCTGTACAGATTTCCAGCCTGTGCACAC
	ACCCGGAGGTGTCTCCCGTGTCCACGCTGGGCTCCAGTCCCACCTGAGCTTCACGGTGTGTTCCCTGCACAATGTCCCAGAGACTTGGGCACACAG
Exon18 139678883 - 139679005
	CTACAAAGCATTTTCGTTTTCCTGCTGGCTCACATATGCTGGGAAGAAGCTGTGCCAAGTGAAAAGCTGCAGACCCCTGCCAGTCACAAAGTCATTCTCC
	CTTTTGGTCAACTGGAATGAAAT
Exon19 139685415 - 139685546
	AATCAATTTTCCTCTTGAGATAAAGTCACTTCCAAGAGAATCCATGCTCATTATAAAACTGTTCGGGATTGACTCTGCCACCCACAGCACAAATCTGCTG
	GCCTGGACCTGCCTTCCACTGTTTCCAAGACA
Exon20 139691827 - 139691941
	GGAGTCTGTGCTGGGGTCTAGGCTGTTCAGTGTGACGTTACAGAGTGAGCCTCCTATCGAAATGATAGCTCCAGGCGTATGGGATGGGAGCCAGCCTTCC
	CCACTGACCCTGCAG
Exon21 139696620 - 139696750
	ATAGATTTTCCAGACGCCGGGTGGGAGTATCTGAAACCTGAGTCTGAAGAGAACAGAACTGACCATGAAGAGCCGCCAAGAGAGTGTTTAAAACACATCG
	CCAAACTCTCCCAGAAGAAGTCTCCCTTGCT
Exon22 139703238 - 139703426
	ACTTTCTGAGGAAAAGAGGAGATATTTGTGGTTTTATCGTCTCTACTGCAACAATGAGAACTCCTCCCTCCCTTTGGTCTTGGGCAGCGCCCCTGGTTGG
	GATGAAGAGACAGTTTCTGAAATGCATGCAATCTTGAGAAGGTGGACGTTTTCACACCCATGGGAAGCTCTTGGTCTTTTGACTTCCAG
Exon23 139717211 - 139717304
	GTTTCCAGACCAAGACATTCGTGAAGTTGCCGTTCAACAATTAGACACCCTCTTGACTGACGAGCTGCTGGACTGCCTCCCACAGCTAGTGCAG
Exon24 139720930 - 139721024
	GCTGTCAAGTTTGAGTGGAACCTCGAAAGTCCCTTGGTGGAACTCCTGCTTCGTCGCTCCTTGCAAAGCATCCGAGTGGCTCACCGTCTGTACTG
Exon25 139789966 - 139790216
	AATACACTGACCAtgatggtttacgccagctgtcaacatgttggcaagatctagactcactttgaagacaagtctctggcccggctgtgtctttaaggag
	ttcatcggttgtgtttactgaacttgaaggacacctctaaatgtagacagcgtcattttatgggccggggatactgaattgaataaaacagagaaaatga
	gctaagcaccagcattcatggcttctgcttcctgcccgttgctgtgatggg
Exon26 139792409 - 139792589
	GCTGCTACGGGATGCCCAAGGTGAAGCCTACTTTAAAAGCTGGTATCAGGAGCTTTTGGCCGCTCTCCAGTTCTGTGCAGGAGAAGCCCTGAATGAAGAG
	CTTTCCAAGGAGCAGAAACTTGTCAAACTTCTGGGTGATATTGGAGAAAAAGTGAAGTCAGCCAGTGACCCTCAGAGAAAG
Exon27 139796083 - 139796190
	GATGTGCTAAAGAAAGAGATTGGCAGTCTAGAAGAATTCTTTAAAGATATAAAGACTTGCCATCTTCCTCTGAACCCGGCACTGTGCATAAAAGGAATTG
	ATCGGGAT
Exon28 139799726 - 139800053
	CACAGGAAGCCTTTCAACTCTCGAACAAATTGGGAAACTGAGCGCAAGGGAAAGTTGAGTGGAATTAGCCAACCTGGGAAAACTTCAATCATAAATGGGG
	AATGAGCTTAAAGAAACGGAAGAAGGAAACTCTGCTGAGCTCTCAACTACAGAGAAAGCGTTCTCTAACAAAGGGATGTATCCTTTCTACAGACCTCATC
	TCAGAGTCTCAGCTCCTGGTGTCTTCTACCAAAAGGCACAAGATAAGGTTTCTGGTTCTCTGCTTTTTAGTGTAACAGAGACACATGAAGGAATGGTTTT
	TAAATCGTATTGATAATAAAATACAGGT
Exon29 139801311 - 139801403
	GCTTGCTCGTATTTCACATCCAACGCTTCGCCATTGAAGATTACTTTCATCAATGCTAATCCAATGGGCAAAAATATCAGTGTTATTTTTAAG
Exon30 139803789 - 139803918
	GCCGGAGATGATCTTCGGCAGGATATGCTTGCTCTGCAGATTATTCAAGTGATGGACAACGCTTGGCTGCAGGAGGGCCTCGATATGCAAATGATCACTT
	ATGGATGTCTATCCACAGGAAGAGCCCAAG
Exon31 139807886 - 139808022
	GATTCATAGAGATGGTGCCTGATGCTGTAACCCTGGCCAAGATCCATCTGCACTCTGGGCTGATCGGACCCCTGAAAGAAAACACCATCAAGAAGTGGTT
	CAGTCAGCACAACCACTTAAAGGAAGATTATGAGAAG
Exon32 139808734 - 139808903
	GCCTTGAGGAACTTCTTTTACTCTTGTGCTGGCTGGTGTGTGGTGACATTCATCTTGGGAGTCTGTGACCGACATAATGACAATATCATGCTGACAAAGT
	CAGGTCACATGTTTCATATTGACTTTGGAAAATTCTTGGGTCATGCGCAAACATTTGGCGGTATCAAAAG
Exon33 139823824 - 139823980
	GGACAGAGCCCCTTTCATTTTTACTTCAGAGATGGAGTACTTTATTACTGAGGGTGGAAAAAACACACAGCATTTTCAAGACTTCGTGGAGCTTTGCTGC
	AGAGCTTACAACATCGTCAGGAAACACAGCCAGTTGATCCTGAGCCTTCTAGAGATG
Exon34 139830487 - 139830596
	ATGCTGCATGCAGGACTGCCTGAGCTAAGGGGAATCGAAGACCTGAAGTATGTACATAACAATCTTCGCCCACAAGACACAGACCTGGAAGCCACAAGTC
	ATTTCACCAA
Exon35 139844587 - 139844776
	GAAGATAAAGGAAAGTCTGGAGTGTTTCCCAGTGAAATTGAATAACCTGATCCACACACTTGCACAGATGCCAGCCTTAAGCCTTGCCAAACCTGCCCCT
	CAGACTCTTCTCCAGGAATCCTGCATCCTGAATAAGACCAGGACAATTCAGAGAGTCACAATTTTAGGGTTCAGCAAGACACACAGCAAC
Exon36 139845249 - 139845370
	CTGTACCTGATGGAGGTGACATGCAGTGACAATAGGAGAAGCCTGACCAAGAAGTCCTTCGAGCAGTTTTACAGACTTCACAGCCAAATGCAGAAGCAGT
	TCTCCTCCTTGGCTCTCCCAGA
Exon37 139848045 - 139848590
	GAAGTAGCAGGGAACATCCTGGTGAAAAGTCGCCACTGCTTCTGTGTCTGCTGGAGAAGATTCACGAGCCTCCTCGTTTCTCCCTCCAGGAAGCAACCTA
	AGCAGGTCTTTATCTGCACCAAATGGCAGACATATAAAAGGAAGCAACAGTAAACTGCTGAAAACATGCAATTAGGTAGGAAAAAAATATTACCAAATGG
	GACCACCAACGTCAGGTCATCCCAGCAAGCTGATCAGAAGCGCAACCCAAGACGCTCTTCAGATGGATCACGGAGAAGCCTCCTGCTCAGACTCTTGAGG
	ACAGTGCGCCTGTGATTAACATGACTGAGGCCAGATGGAAGCAGATGCTACTCGACGAAATGTCTAATTTATTTCATGCAATAATGTCTGTCAAGGGTCC
	AGAAGAAACAACAGTCAGAACTCTTTGAAAAACTATAAATCATTAATTTCATAAACTATGTATTAGCCCCTACATGTACTGAGAGGAAACATTTGTGGTC
	CGCTATAAATACAGTAATAAAGATCATATTAAATTAATTTAATGCT
Exon38 139848797 - 139848905
	ATTTCCTCACTGGTGGCATCTACCTTTCACAGACTCAGATCACAAGAGAATCAGAGATCTGAGTCACTACGTGGAACAGGTGCTACGCGGATCTTATGAA
	GTTGCAAAC
Exon39 139866498 - 139866573
	AGTGATTGTGTACTTAGCTTTTTTCTCTCTGAACATATTCAACCAACACTTGAAGACTCTCCATTTGTGGACCCAG
Exon40 139884503 - 139884597
	GTGAGAACTCTCTAGACAAGAGCCCTAAGGTGCAGTTACTGATGACGTATGAGGACTCGAGGCTCACCATCCTAGTGAAACACTTGAAAAACATC
Exon41 139890714 - 139890797
	TGTAAATATTCCCAGACCTTCAAAGTTACCATGACCAAGAAGCCAGCGTTTCTGAATCTCATCACTGTGCCTTGCTTGCACCAA
Exon42 139906227 - 139906352
	CATCTCCCAGATGGCTCTGTGCCCAGTGCACATGTTGAAATTTATCTTCTACCACATCCCAGTGAAGTTCGGAGAAAGAAAACAAAGTGTGTTCCAAAAT
	GCACTGACCCAACTTACAATGAAATT
Exon43 139916312 - 139917804
	GTGGTATATGATGAAGTCTTGGGGCTCCAGGGCCATGTTTTAATGCTTATCGTGAAGAGCAAAACTGTATTTGTGGGAGCAGTTAACATCCAGCTCTGCA
	GTGTACCCCTCAATGAAGAAAAGTGGTACCCACTAGGAAACAGTATCATCTGACTAACGCCACGAGCGTATGCATTACTGCTTAAGTACTTGTATGTTTT
	CAGCTTCTACTTGCCTCTGTCACATATGCAAGGCATCTTTCTCCTGGGAGATAGCTTCGAGcagtggctctcagccttcctaaagctgtggccctttaat
	atagctcctggtggttgtagtgacccaaaccataaaattactttagttgctacttcataattgtaattttgatactgttgtgaattgcaatgtaattatc
	tgatatacaggatctctactatgtgacccatgtgataaaagggacatttgactcccccaaagggccgtggcctatgggttgagaaccATAGAATGTGAAG
	GTTACAAAAGAACCAGATCAAAATCTGCCTTTTGTAGCTATTTCTTCCCTATCTTGTCCTTATTTTCTTATCATATTTTCTCCTTGGAATATCCATCATG
	TAAAATTCCATATGCAAAGTAATCAAAGAGTGATTATTTTCAATATGCATTTTGAAAGCAACGTAAGTTCACATTTTGTCTTAATTGCTTGTTGAGGTCA
	AAAATTATATTTTCAAGGTGTTTCTCTAAAGCTGGGAGAAGTTCATGAATGAATCTAAAGGCTAAGAATACCTGCAATATATTCCAAGCTTAAATATGTG
	TACAAACCACATGTCTAGTCATGAGTGGATTTACTGAGAGAACTGGTGATCTCCCACCATATGCTATAATTTTTCTATCAAGAAAAGGCCTAAGATTTTC
	TATTACATAGATTTTTTTCTTTAAGAATTTCATGCCTATATATAATGCCTTTCATTACTCTAGTTTCTCTCTGTTTTTGTTGCTCCCACACCCATCAACA
	ACTGTTCTTCTCAAAAAAATCCTGTATTCCTATAGGAAAttttgtttttaagatgggaatcttgctatatatcctagctgacctagaacttactatgtag
	accaagctgggcccaaaatcacagtggtcctcctgcctctgtttccctatggctgggactccaAATCATTGGTCCTGATCTGTAATCTTTAAATTCAGTT
	CTTAGAATTTGATGTTGACTAATCCATTGTCATTGTGTCTCCCAGCCTCCAATGTGCTCACACCTTAAGTCTTACTAATCCCAAACTCAGAATGTCAGAC
	TTTCAAGTTCACTGTTTATAACTCTTTTTCACTTGTTAAATGCTATCATTGCACTCGAACCTACCCCCTGTTCTCACCATGAACAGAGTAGATGATCTTA
	CAGAGTGTTACCAGCATAGTAGACAAACCCAGAGTAGTGCGCCTTCAAGATAATCAAACTGGAGGTTCTAAAAATAAAACATCTACCATGTAA

Links between exon parts

From
exon
To
exon
Splice
sites
SupportExamples
12+3dbEST_CF175135.1,GB_BC099684.1,NIA_B0949C08-5,
16+1dbEST_BB653781.1,
14+3REF_NM_207683.2,GB_BC150813.1,GB_AB008791.1,
26+3dbEST_CF175135.1,GB_BC099684.1,NIA_B0949C08-5,
36+2dbEST_BB612782.1,GB_AK076317.1,
34+3dbEST_BB872353.1,dbEST_BY733493.1,GB_AK090232.1,
45+5dbEST_BY733493.1,REF_NM_207683.2,GB_BC150813.1,GB_AB008791.1,GB_AK090232.1,
56+5dbEST_BY733493.1,REF_NM_207683.2,GB_BC150813.1,GB_AB008791.1,GB_AK090232.1,
67+8ENSMUST00000087657,ENSMUST00000032353,REF_NM_207683.2,GB_BC099684.1,GB_BC150813.1,GB_AB008791.1,GB_AK090232.1,GB_AK076317.1,
78+8ENSMUST00000087657,ENSMUST00000032353,REF_NM_207683.2,GB_BC099684.1,GB_BC150813.1,GB_AB008791.1,GB_AK090232.1,GB_AK076317.1,
89+8ENSMUST00000087657,ENSMUST00000032353,REF_NM_207683.2,GB_BC099684.1,GB_BC150813.1,GB_AB008791.1,GB_AK090232.1,GB_AK076317.1,
910+3ENSMUST00000032353,GB_BC099684.1,GB_AK090232.1,
911+5ENSMUST00000087657,REF_NM_207683.2,GB_BC150813.1,GB_AB008791.1,GB_AK076317.1,
1112+5ENSMUST00000087657,REF_NM_207683.2,GB_BC150813.1,GB_AB008791.1,GB_AK076317.1,
1217+0
1213+1ENSMUST00000087657,
1216+0
1314+1ENSMUST00000087657,
1415+1ENSMUST00000087657,
1516+1ENSMUST00000087657,
1617+4ENSMUST00000087657,REF_NM_207683.2,GB_AB008791.1,GB_AK076317.1,
1718+5ENSMUST00000087657,REF_NM_207683.2,GB_BC150813.1,GB_AB008791.1,GB_AK076317.1,
1819+5ENSMUST00000087657,REF_NM_207683.2,GB_BC150813.1,GB_AB008791.1,GB_AK076317.1,
1920+5ENSMUST00000087657,REF_NM_207683.2,GB_BC150813.1,GB_AB008791.1,GB_AK076317.1,
2021+5ENSMUST00000087657,REF_NM_207683.2,GB_BC150813.1,GB_AB008791.1,GB_AK076317.1,
2122+5ENSMUST00000087657,REF_NM_207683.2,GB_BC150813.1,GB_AB008791.1,GB_AK076317.1,
2223+5ENSMUST00000087657,REF_NM_207683.2,GB_BC150813.1,GB_AB008791.1,GB_AK076317.1,
2324+5ENSMUST00000087657,REF_NM_207683.2,GB_BC150813.1,GB_AB008791.1,GB_AK076317.1,
2426+8dbEST_BB629949.1,dbEST_AV236835.2,ENSMUST00000087657,REF_NM_207683.2,GB_BC150813.1,GB_AB008791.1,GB_AK076317.1,GB_AK036916.1,
2526+12dbEST_BB666611.1,dbEST_BB666286.1,dbEST_CJ046265.1,dbEST_BB609184.1,REF_NM_011084.2,GB_AB008792.1,GB_AK054415.1,GB_AK054271.1,GB_AK054266.1,GB_BC061142.1,
2627+18dbEST_AV236835.2,dbEST_BB666611.1,dbEST_BB666286.1,dbEST_CJ046265.1,REF_NM_207683.2,REF_NM_011084.2,GB_BC150813.1,GB_AB008791.1,GB_AK076317.1,GB_AB008792.1,GB_AK054415.1,GB_AK054271.1,GB_AK054266.1,GB_BC061142.1,
2729+16dbEST_BB666611.1,dbEST_BB666286.1,dbEST_CJ046265.1,dbEST_BB666281.1,REF_NM_207683.2,REF_NM_011084.2,GB_BC150813.1,GB_AB008791.1,GB_AB008792.1,GB_AK054415.1,GB_AK054271.1,GB_AK054266.1,GB_BC061142.1,
2728+2dbEST_AV236835.2,GB_AK076317.1,
2930+14dbEST_BB666286.1,dbEST_BB666281.1,dbEST_CB945724.1,ENSMUST00000087657,REF_NM_207683.2,REF_NM_011084.2,GB_BC150813.1,GB_AB008791.1,GB_AB008792.1,GB_AK054415.1,GB_AK054271.1,GB_AK054266.1,GB_BC061142.1,
3031+11ENSMUST00000087657,ENSMUST00000111868,REF_NM_207683.2,REF_NM_011084.2,GB_BC150813.1,GB_AB008791.1,GB_AB008792.1,GB_AK054415.1,GB_AK054271.1,GB_AK054266.1,GB_BC061142.1,
3132+8ENSMUST00000087657,ENSMUST00000111868,REF_NM_207683.2,REF_NM_011084.2,GB_BC150813.1,GB_AB008791.1,GB_AB008792.1,GB_AK054271.1,
3233+8ENSMUST00000087657,ENSMUST00000111868,REF_NM_207683.2,REF_NM_011084.2,GB_BC150813.1,GB_AB008791.1,GB_AB008792.1,GB_AK054271.1,
3334+8ENSMUST00000087657,ENSMUST00000111868,REF_NM_207683.2,REF_NM_011084.2,GB_BC150813.1,GB_AB008791.1,GB_AB008792.1,GB_AK054271.1,
3435+8ENSMUST00000087657,ENSMUST00000111868,REF_NM_207683.2,REF_NM_011084.2,GB_BC150813.1,GB_AB008791.1,GB_AB008792.1,GB_AK054271.1,
3536+8ENSMUST00000087657,ENSMUST00000111868,REF_NM_207683.2,REF_NM_011084.2,GB_BC150813.1,GB_AB008791.1,GB_AB008792.1,GB_AK054271.1,
3638+8dbEST_BG970531.1,ENSMUST00000087657,ENSMUST00000111868,REF_NM_207683.2,REF_NM_011084.2,GB_BC150813.1,GB_AB008791.1,GB_AB008792.1,
3637+2dbEST_BB553694.2,GB_AK054271.1,
3839+8dbEST_BG970531.1,ENSMUST00000087657,ENSMUST00000111868,REF_NM_207683.2,REF_NM_011084.2,GB_BC150813.1,GB_AB008791.1,GB_AB008792.1,
3940+8dbEST_BG970531.1,dbEST_AA066552.1,ENSMUST00000111868,REF_NM_207683.2,REF_NM_011084.2,GB_BC150813.1,GB_AB008791.1,GB_AB008792.1,
4041+1dbEST_AA066552.1,
4042+8dbEST_BG970531.1,ENSMUST00000087657,ENSMUST00000111868,REF_NM_207683.2,REF_NM_011084.2,GB_BC150813.1,GB_AB008791.1,GB_AB008792.1,
4243+8dbEST_BG970531.1,ENSMUST00000087657,ENSMUST00000111868,REF_NM_207683.2,REF_NM_011084.2,GB_BC150813.1,GB_AB008791.1,GB_AB008792.1,