NIA Mouse Gene Index (mm92)

Exon structure for U007525

chr6 +

Exon1 140372575 - 140372777
	gccgcgcgcccTGCGCTCCTTtcgctcgctcgctcgctcgctcgctcgcGCCCTCCTTCCTCAgcggcggcggcagcacaaggcggcggcggcggcggcC
	GGGGAGCAGACATGGCGGCCGACCTGAACCTGGAGTGGATCTGCTCGCTGCCGCGCTCCTGGACGTACGGGATCACTAGGGGCGGCCGCGTCTTCTTCAT
	CAA
Exon2 140372898 - 140372977
	CGAGGAGGCCAAGAGCACCACCTGGCTACACCCGGTCACCGGCGAGGCCGTGGTCACCGGGCACCGGCGGCAGAGCACAG
Exon3 140375019 - 140375076
	ATTTGCCCACTGGCTGGGAAGAAGCATATACGTTCGAAGGTGCAAGATACTATATAAA
Exon4 140381245 - 140381575
	CGCCTCTCCTCTAAAGACTTAATCTCAAAATCACTGTGTGTTTGGGATGGTGGGAGAGTGAGGAATAAAACTGGGCTAGAAATGGTGGGAAGACTGGAGA
	CTAGCCTGATGTAAACAACCAATCGACTGTCTGGTGAGACCTTTTCATTGTGTTTGACAGATACATGTAAGTTAGGGTTAGTGGTGAAAAGGTTTGTGTA
	TAAATGTGTCAGTTGGAGTTTTGTCAGTTGACAGTAGGAGTTGTCAGTTGGTGTCATAAGAATTTACAAGAAGAGGAGGCAGGTTGGTGAGCTGCCCTGG
	CCCTGCTTGGAGGTAAAAAGACTTGAGCAAG
Exon5 140473386 - 140473469
	CCACAATGAAAGGAAAGTGACCTGCAAGCATCCGGTTACAGGACAGCCATCCCAAGACAACTGTATCTTTGTTGTGAATGATCA
Exon6 140474360 - 140474480
	GACTGTTGCAACCATGACGTCCGAAGACAAGAAGGAACGACCCATAAGTATGATAAATGAAGCTTCCAATTACAACATGGCTTCAGATTATGCAGTGCAT
	CCCATGAGCCCTGTGGGCAGG
Exon7 140474978 - 140475082
	ACCTCGCGGGCCTCCAAAAAGGTTCATAATTTTGGGAAAAGGTCCAATTCAATTAAAAGGAACCCTAATGCACCTGTGGTCCGGCGTGGCTGGCTGTATA
	AGCAG
Exon8 140477082 - 140477154
	GACAGCACCGGCATGAAGCTGTGGAAGAAGCGCTGGTTTGTGCTCTCTGACCTTTGCCTTTTCTATTACCGAG
Exon9a 140482983 - 140483079
	ATGAGAAGGAGGAGGGTATTTTGGGAAGTATCCTGTTGCCTAGTTTTCAGATAGCCATGCTCACTGCTGAGGACCACATCAATCGCAAATATGCTTT
Exon9b 140483080 - 140483083
	TAAG
Exon9c 140483084 - 140483881
	GTAAGGAAACGTGCGTGCAGTGTTTGAAGCTTTAAAGAACAGATACTGACCCATAAACTATTGTACAAAAGAACTCCCAGTAGCCATGTGTGCATCTAAA
	GTGTTTTGGTggtgctagagagatggttcagtggtccagagcactaactgctcttctggagaacctgggtttaattgccagtgccacatagagctcacaa
	ctgtgactccaataccaaagaatccagtgccctcttctgtcacagacacacatgcaggcaaaacactcatgcacataaagtaaaaTTCAAAAATAGAGCA
	TAAGGGTTAGCGATGTTACTGTCCTTTTAGGAAGCACGTACTAGCATGGCACAATGAATTCATGGATGGCTGTAGATCTCTGTTCTCAGTTATTATTTCC
	TCAGATGAAATATTTGGGAAGAGTATTGGAAGCCATAGCTCTTCATTATGACATGTTCGCAGACTCTTTGGGATAGCCTTAAAGAGATTCTCAAGTACAC
	AATGCTCGGATCCCACCTAGTGCGGGCCTTTTGCTAAGAATATGTTGCATTGGGATTCACCGTGAAGCTAAAAGAGAAGTCAGTTAAAGAGAAATGTTTA
	ACAATCTGCAGTGTTAAAATAGCAATAAAAGCGGCCACTGCACTTGGTATAGATTTTCTGTGATATGAGTTTGATTTGTTGTGTCTTTTGCCTGTAACAG
	TAGTAATCACTGTTTCAACTTTTCTTTTGTGGTATTTCACCTAAATTCCGAGCTGTATGACTGCATTTCTTGATGTTGAGTCTGCTCCTGTCGGCATG
Exon10 140485169 - 140485284
	GCAGCCCACCCAAACATGCGGACCTATTATTTCTGCACCGATACAGGAAAGGAGATGGAGCTGTGGATGAAGGCCATGTTAGATGCTGCTCTGGTGCAGA
	CAGAACCTGTGAAAAG
Exon11 140485527 - 140485544
	AATTACCTTTAATTTCCG
Exon12 140492241 - 140492708
	AGTGGACAAGATTACAACTGACAGTGCATCAACCAAAGAAACCAATAACATTCCCAACCACAGAGTTCTCATTAGACCCGAGGTCCAAAACCATCAGAAG
	AATAAGGAAATCAGCAAAATTGAAGAAAAAAGGGCCTTAGAAGCTGAAAGATACGGATTTCAGAAGGACGGGCAAGATAGACCATTAACAAAAATTAACA
	GTGTGAAGTTGAACTCCCTGCTATCAGAATATGAAAGCGGGCCAGACTGCCCACCTCAGAATGTACACTACAGACCCATCAATGTGAATAGTTCTGACGG
	CAAAGCGGTGAATGTCAGCTTGGCAGATGTCCGGGGTGGGAGTCACCCAAATGCAGGGCCCCTAGCCACAGAGGCCGACCGAGTCATTCAGAGAACGAAT
	TCAATGCAACAGCTAGAGCAGTGGATTAAAGTCCAGAAAGGACGGGGTCTTGAAGAAGAGCCCAGAGG
Exon13 140499282 - 140499744
	AGTAATTTCTTATCAAACATTGCCAAGAAATATGCCAAGCCACAGAGCCCAGATCCTGGCCCGCTGCCCTGAAGGTTACCGGACACTCCCGAGAAACAGC
	AAGACCAGACCTGAGAGTATCTGCAGCGTAACCTCTTCTGGTCATGAGAAGACAGGGCCGGGAGCAGAAGAGAAGCGGCGATCCATGAGAGATGACACCA
	TGTGGCAGCTGTACGAGTGGCAGCAGCGCCAGTTTTACCACAAGCAGAGCACCCTCCCTCGGCACGGCTGCCTGAGCAGTCCCAAAGCCATGGTGCAGGT
	GTCTGACCAGACGATGCACTCCATCCCCACGTCACCTTCCCATGGGTCAGCAGCTGCTTACCAGGGCTTCTCCCCTCAGCGGACGTACAGGTCAGAAGTG
	ACCTCGCCCATCCAGAGAGGAGATGTGACGATAGACCGCAGGCACAGGCCTCATCACCCTAAG
Exon14 140501236 - 140501319
	CATGTCTATGTAGCTGACAGAAGGTCAATGCCAGCTGGCTTAACTTTACAGGCTGTTAGTCCCCAGAGCCTCCAAGGCAGAACG
Exon15 140504472 - 140504591
	CCAGAGGAGCTCACACTGCTGCTAATAAAGCTGAGACGGCAGCAGGCAGAGCTGAGTAGTGTCCGGGAGCACACCTTAGCACAGCTCATGCAGCTGAAAC
	TTGAGGCCCACAGCCCAAAG
Exon16 140505325 - 140505378
	AATGAGATTCTTTCACATCATCTCCAAAGGAACACCATATATTTGGATCATCAG
Exon17 140512089 - 140512169
	ATGAAAGAAAATGAACCTATTATCACCATGGTTCACACAATGATTGAGAACTCGGCGCTAAGACCACAACTGTACCAACAA
Exon18 140517367 - 140517402
	TTCTTAAGACAGAAGAACAAGATAAGTCTCTATTGT
Exon19 140517874 - 140517936
	CTGTCACAAGATGAATGTAGAGGCACATTATACAAATACAGACCTGAAGAAGCAGGTATTGAT
Exon20 140518627 - 140518707
	GCCAAATTAAGCAGATTGTGTGAACAGGATAAAGTGGTCCGAGCGCTGGAGGAGAAGCTGCAGCAGCTGCACAAGGAGAAA
Exon21 140518842 - 140518991
	TACACGCTTGAGCAAGCCTTGCTGTCAGCCAGCCAAGAGATAGAGATGAATGCTGATAACCCAGCTGCCATTCAAACTGTGGTGTTGCAGAGGGATGACC
	TGCAAAACGGACTGCTGAGCACGTGTCGGGAACTCTCCCGAGCCACTGCT
Exon22 140521386 - 140521487
	GAGCTGGAACGAGCCTGGAGAGAATATGACAAGTTGGAATATGATGTGACTGTTACCAGGGACCAGATGCAGGGTCAGCTCGACCGCCTTGGAGAAGTGC
	AG
Exon23 140525748 - 140525859
	AGTGAGTCGGCAGGAATTCAACGGGCACAGATTCAAAAGGAGCTCTGGAGAATTCAAGATGTCATGGAGGGGTTGAGCAAACACAAACAGCAAAGAGGCT
	CTTCAGAAACAG
Exon24a 140527948 - 140527950
	TAG
Exon24b 140527951 - 140527997
	GTCTGGCAGGATCAAAGCCTTTCTCATCAGTTAAGTACAAGAGCGAG
Exon25a 140528868 - 140528980
	GAAGAGGAAGTAGTCCCACCTCGGCCTCCACTTCCTCGGTCTTATGACTTTACAGAGCAGCCTCCCATAATCCCCCCTCTGCCCAGTGATAGCAGCTCCT
	TGCTCTGTTATAG
Exon25b 140528981 - 140529056
	CAGGGGCCCCGTGCATCTGCCTGAAGACAAGAAGATTCATCAAGTTCAAGGATATCCAAGAAATGGATCTCACTGT
Exon26 140530489 - 140530609
	GGTCCAGATTATAGACTCTACAAGAGTGAGCCAGAGTTAACCACAGTGGCAGAAGTCGATGAATCTAACGGAGAAGAAAAGTCAGAGCCAGTTTCTGAGA
	CAGAAGCTCCAGTCGTTAAAG
Exon27 140532354 - 140532469
	GTTCCCATTTTCCAGTCGGAGTTCCTCTGAGAACAAAGTCACCCACACCCGAGTCCTCCACGATAGCTTCCTATGTGACCTTGAGGAAGACTAAGAAGAT
	GGTGGAGCTAAGAACG
Exon28 140534830 - 140535021
	GAAAGACCAAGAAGTGCCGTGGAGCAGCTGTGTCTGGCTGAGAGTGCTCGACCTAGAATGACTGTGGAAGAGCAGCTAGAGAGGATCAGGAGACACCAGC
	AGGCCTGCCTGAGGGAGAAGAAGAAGGGGCTGAGTGTCCTCGGTGCTTCCGACCCGTCAGACGTGAGGGACAGTCCACTCAGGCTTACTCAG
Exon29 140537696 - 140537836
	ACTCTAAGGAGGGATGATAACGTTAAGGAGCTAGACACCGTCCACAGAGAAAATGATGTAAAGCCAGACTACGAGACTCCAGCAGCACAGTGTGCTCACC
	TAGAAGACGCTGAACCCCAGAATGCAGACATCGGCAGAAAG
Exon30 140538167 - 140538276
	CTAAAAAGATCTGAAATGCTTTACACACCTGAACCAAATGGAATGGCTTCTGAGGAAGTGACGGAGAAGGAAAGACAGAAAGAGCAGGTGCATGCCGATG
	GGTCATGCAG
Exon31 140540149 - 140540285
	CCCTCAGGAAGAGACGGCCATGACAGAGCATCAGATGGAAGGCCCCCCTGAGGAAGCAGAGAGTCTTCATGAGGAGGAAGAAACTCTTGCTTCCTGTGAG
	CCAGCTCCTGAGATTCCTAGGGAGAATCAAACCACAG
Exon32 140542076 - 140542178
	TGAGAAGTCTGTCCCCGTCTCCTGACTCCTCCACGGCAGCAGATCCGCCCACTCCTCCACAGCTCAGGGAAGGATCGCATTTCATGTGTGTGTAGTCGCA
	GAA
Exon33 140544770 - 140545633
	CTGCACTGGCGTCTGTTGAGAGCTCACAGAGCTGAAGCTGTGGACCTCAGTGGTGTAAGAAGATGTACAATATACCTTAACTCTATGAAATTCATAGTTC
	GGATGCTGCTGACCACAGAGCATCATTTTATCACCTTTGGAAAATGTTTATTCCAAACTAGCTTTAATGGCCCGTACGTGCACTCCGTAGTGTCAAGGTC
	ACCGTCCTCCGCAGTCCGCCCACCCGCCCGCTTGCTGCTATTTGAGTTCAGAGCGTATCAGTCAGGTGCTTTCTCCCTCATGCTCCATCAGAGCTTGCTT
	GGTTGCAGTTCCCAGGTCTGGATGCTTAAGTCTCAGTGAACTTGGGTCTCTTGCTTTTCAGTGAGGCTATGCTTTCCTTCGAAGCTTGTTTGCTTCCCTC
	CTTTTTTCTTCCCATTTTGGCTTCTGCAGTACTTCATTTGACACTTGATTTGtaaaaattttatataaatatatttaaaatGTGCCATTTTCTCACTGCT
	CAGTGAAGTCTGTCCTGTTTTCTGCTCTAACCCCTCCTCAGTGAGACTGCACCATCAGCAGTCCCTGCCTCGCTCCGTCTGCTTCCACACAAATGCTGTT
	GCTTAGCTTTCCTTTCAAAAGCCAAACAATTACAAGCGTAGGTATTTTGAAGTACTGGACATTTATGTCATTGGGATAGATGTGTACAGCAATAAGCAGG
	CTTTTAGATCCAGTACTTGGTTTGTGTACAGATGTAATTATGTTCATTGTGTGGAAGTTACACAGTGAACACATGTAATAAGGCTGCTTACTAGAGTTTA
	ATGCAAATGTTCATAGCTCATTTCTTTTTTTATCATGTTAAATAAATGTTGATGTTCTTAAATC

Links between exon parts

From
exon
To
exon
Splice
sites
SupportExamples
12+25dbEST_CJ170110.1,dbEST_CJ186722.1,dbEST_CJ182663.1,dbEST_CJ169585.1,REF_NM_144920.3,
23+28dbEST_CJ170110.1,dbEST_CJ186722.1,dbEST_CJ182663.1,dbEST_CJ169585.1,REF_NM_144920.3,
35+32dbEST_CJ170110.1,dbEST_CJ186722.1,dbEST_CJ182663.1,dbEST_CJ169585.1,REF_NM_144920.3,GB_AK129423.1,
45+2dbEST_BY706778.1,GB_AK131741.1,
56+39dbEST_CJ178234.1,dbEST_BY260485.1,dbEST_CJ184750.1,dbEST_BF462032.1,REF_NM_144920.3,GB_AK129423.1,GB_AK131741.1,
67+37dbEST_BF465825.1,dbEST_BF466336.1,dbEST_BE996492.1,dbEST_AW124767.1,REF_NM_144920.3,GB_AK129423.1,GB_AK131741.1,
78+34dbEST_BF466336.1,dbEST_BE996492.1,dbEST_AW124790.1,dbEST_BE651592.1,REF_NM_144920.3,GB_AK129423.1,GB_AK131741.1,
89a+33dbEST_BE996492.1,dbEST_BE651592.1,dbEST_BG067450.2,dbEST_CN459414.1,REF_NM_144920.3,GB_AK129423.1,GB_AK131741.1,
9b10+33dbEST_BE996492.1,dbEST_BE651592.1,dbEST_BG067450.2,dbEST_CN459414.1,REF_NM_144920.3,GB_AK129423.1,GB_AK131741.1,
9c10+4dbEST_BG917156.1,dbEST_CK393324.1,GB_BC033481.1,NIA_K0857A04-5,
1011+7dbEST_BY620591.1,dbEST_BB057318.1,dbEST_BB057311.1,ENSMUST00000087622,REF_NM_144920.3,GB_AK129423.1,
1012+37dbEST_BG067450.2,dbEST_CN459414.1,dbEST_CO431955.1,dbEST_CN460908.1,GB_AK131741.1,GB_BC033481.1,
1112+7dbEST_BY620591.1,dbEST_BB057318.1,dbEST_BB057311.1,ENSMUST00000087622,REF_NM_144920.3,GB_AK129423.1,
1213+34dbEST_CV884088.1,dbEST_CV784305.1,dbEST_BG808970.1,dbEST_CN457543.1,REF_NM_144920.3,GB_AK129423.1,GB_AK131741.1,GB_BC033481.1,GB_AK216370.1,GB_BC031390.1,GB_BC014853.1,GB_BC021505.1,
1314+29dbEST_CB520425.1,dbEST_CF898459.1,dbEST_CF897607.1,dbEST_BI688478.1,REF_NM_144920.3,GB_AK129423.1,GB_AK131741.1,GB_BC033481.1,GB_BC031390.1,GB_BC014853.1,GB_BC021505.1,
1419+16dbEST_CF897607.1,dbEST_BI688478.1,dbEST_CV782940.1,dbEST_CX563395.1,GB_BC033481.1,GB_BC031390.1,GB_BC014853.1,GB_BC021505.1,
1416+1dbEST_CX563895.1,
1415+5dbEST_CB520425.1,dbEST_CB724242.1,ENSMUST00000087622,REF_NM_144920.3,GB_AK129423.1,
1516+4dbEST_CB724242.1,ENSMUST00000087622,REF_NM_144920.3,GB_AK129423.1,
1617+3ENSMUST00000087622,REF_NM_144920.3,GB_AK129423.1,
1619+4dbEST_CB724242.1,dbEST_CX563895.1,dbEST_CA579277.1,NIA_K0735B11-5N,
1718+3ENSMUST00000087622,REF_NM_144920.3,GB_AK129423.1,
1819+3ENSMUST00000087622,REF_NM_144920.3,GB_AK129423.1,
1920+20dbEST_CV782940.1,dbEST_CX563395.1,dbEST_DV650647.1,dbEST_BI688863.1,REF_NM_144920.3,GB_AK129423.1,GB_BC033481.1,GB_BC031390.1,GB_BC014853.1,GB_BC021505.1,
2021+23dbEST_CX563395.1,dbEST_DV650647.1,dbEST_BI688863.1,dbEST_CB724242.1,REF_NM_144920.3,GB_AK129423.1,GB_BC033481.1,GB_BC031390.1,GB_BC014853.1,GB_BC021505.1,
2122+26dbEST_CX563395.1,dbEST_BI688863.1,dbEST_CB724242.1,dbEST_CN525554.1,REF_NM_144920.3,GB_AK129423.1,GB_BC033481.1,GB_BC031390.1,GB_BC014853.1,GB_BC021505.1,
2223+23dbEST_CN525554.1,dbEST_CX563895.1,dbEST_BE291586.1,dbEST_BB660528.1,REF_NM_144920.3,GB_AK129423.1,GB_BC033481.1,GB_BC031390.1,GB_BC014853.1,GB_BC021505.1,
2324b+22dbEST_CX563895.1,dbEST_BB660528.1,dbEST_AU080748.1,dbEST_DV650695.1,REF_NM_144920.3,GB_AK129423.1,GB_BC031390.1,GB_BC014853.1,GB_BC021505.1,GB_BC025596.1,
2324a+4dbEST_CN525554.1,dbEST_CO805732.1,ENSMUST00000032358,GB_BC033481.1,
24b25b+1dbEST_AB575975.1,
24b25a+7dbEST_AU080748.1,dbEST_BU609311.1,ENSMUST00000087622,ENSMUST00000032357,REF_NM_144920.3,GB_AK129423.1,GB_BC014853.1,
24b26+17dbEST_CN525554.1,dbEST_CX563895.1,dbEST_DV650695.1,dbEST_CK636926.1,GB_BC033481.1,GB_BC031390.1,GB_BC021505.1,GB_BC025596.1,
25b26+7dbEST_BU609311.1,dbEST_AB575975.1,ENSMUST00000087622,ENSMUST00000032357,REF_NM_144920.3,GB_AK129423.1,GB_BC014853.1,
2627+25dbEST_DV650695.1,dbEST_CK636926.1,dbEST_BI697209.1,dbEST_BI651884.1,REF_NM_144920.3,GB_AK129423.1,GB_BC033481.1,GB_BC031390.1,GB_BC014853.1,GB_BC021505.1,GB_BC025596.1,
2728+24dbEST_DV650695.1,dbEST_BI697209.1,dbEST_BI651884.1,dbEST_CK622557.1,REF_NM_144920.3,GB_AK129423.1,GB_BC033481.1,GB_BC031390.1,GB_BC014853.1,GB_BC021505.1,GB_BC025596.1,
2829+22dbEST_BE911042.1,dbEST_BI684101.1,dbEST_BG920564.1,dbEST_CO815566.1,REF_NM_144920.3,GB_AK129423.1,GB_BC033481.1,GB_BC031390.1,GB_BC014853.1,GB_BC021505.1,GB_BC025596.1,
2930+19dbEST_BE911042.1,dbEST_BI684101.1,dbEST_CO815566.1,dbEST_BE570482.1,REF_NM_144920.3,GB_AK129423.1,
3032+1GB_BC031390.1,
3031+23dbEST_BB611249.1,dbEST_BM940502.1,dbEST_CK622016.1,dbEST_BI106132.1,REF_NM_144920.3,GB_AK129423.1,GB_BC033481.1,GB_BC014853.1,GB_BC021505.1,GB_BC025596.1,
3133+8dbEST_BM940502.1,dbEST_BQ957931.1,dbEST_BE995058.1,dbEST_CF582729.1,GB_BC014853.1,GB_BC021505.1,
3132+17dbEST_CK622016.1,dbEST_BI106132.1,dbEST_CB204299.1,dbEST_AI550649.1,REF_NM_144920.3,GB_AK129423.1,GB_BC033481.1,GB_BC025596.1,
3233+15dbEST_BI106132.1,dbEST_CB204299.1,dbEST_AI550649.1,dbEST_AA098148.1,GB_BC033481.1,GB_BC031390.1,GB_BC025596.1,