NIA Mouse Gene Index (mm92)

Exon structure for U007610

chr7 +

Exon1 4071010 - 4071026
	ACCTGCACAGGCAGCAG
Exon2 4071311 - 4071382
	CTGCCCCGCGCCGACTTCCAGCTCCGCCCGGTGCCCAGCGGCTTTGCTCCCCGCGACCAAGAGTACCAGCAG
Exon3 4071822 - 4071900
	AGGGGAGGCAGCCGAGGTCTGGGAAGGATTGATATCCTCAAATAGGGAACAGAGATCAGGACTGGGGAAACCAGCTGAG
Exon4a 4074079 - 4074214
	GCCCTGCTGCTGGTGGCAGCCTTGGCTGGGCTTGGTTTAGGCCTGAGCCTCATCTTCATCGCTGTCTACCTCATCCGCTTCTGCTGCTGCAGGCCTCCAG
	AACCCCATGGGGCCAAGAGTCCCCCACCCGGAGGAG
Exon4b 4074215 - 4074257
	GTTGCGTCACCTGGAGCTGCATTGCTGCCCTTCTCGTGGGCTG
Exon5 4076091 - 4076122
	GAACCAATAGGGTGGATGCAGAGATCAGATAG
Exon6 4076222 - 4076333
	TGCCGGCATTGGCATTGGTTTCTATGGTAACAGCGAGACCAGCGATGGGGTGTCCCAGCTCAGCTCAGCACTGCTGCACGCCAACCACACGCTCAGCACC
	ATCGATGACGTG
Exon7 4077125 - 4077345
	GTGCTGGAAACGGTGGAGAGGCTGGGTGAGGCAGTGAAGACGGAGCTGACCACCCTGGAGGAAGTGCTGTCAGTCCGCATGGAGCTGGTGGCTGCCACCA
	GGGGAGCCCGAAGGCAGGCTGAAGCTGCTGCTCAGTACCTGCAAGGACTGGCCTTCTGGCAAGGAGTGTCCCTGAGCCCCGTACAGGTGGCTGAAGATGT
	GACTTTCGTGGAGGAGTACAG
Exon8 4079772 - 4079867
	GTGGCTGGCCTATGTCCTCCTGCTGCTCTTGGTGCTTCTGGTTTGTCTCTTCACCCTCCTGGGCCTGGCAAAGCAGAGCAAATGGCTGGTGGTTGT
Exon9 4080903 - 4080975
	GATGACTGCCATGAGTCTCCTGGTGCTTGTCCTGAGCTGGGGTTCTATGGGCCTAGAGGCTGCCACAGCTGTG
Exon10 4081260 - 4081335
	GGCCTCAGTGACTTCTGCTCCAACCCAGACACCTATGTGCTGAACCTGACCCAGGAGGAGACAGGGCTCAGCTCAG
Exon11 4082183 - 4082238
	ACATCCTCAGCTATTATTTCCTGTGCAACCAGGCGGTCTCCAACCCCTTCCAACAG
Exon12 4082399 - 4082491
	AGGCTGACGCTGTCCCAGCGTGCTCTAGCCAGCATCCACTCTCAGCTGCAGGGCCTGGAGCGGGAAGCTATCCCTCAATTTTCTGCTGCACAG
Exon13 4082739 - 4082767
	TTTCTCTTGGTGCTGGGCCAACAGTGGAG
Exon14a 4082893 - 4082985
	AAGCCCTTGTTATCCTTGGAGGAGACACTGAATGTGACAGAAAGAAGCTTCCACCAGTTGGTGGCGCTGCTGCACTGCCGCAGTCTGCACAAG
Exon14b 4082986 - 4083531
	GTAAGCTCTGGGTGTTTGCCAACCCTGTctctttctccccctcccctttgctttctcttctcttccccctcctctctttctcatactctctctcccccct
	cccgcctttgtccccccccctcccaccccaccccgtgttcttcatcttccaccctctcctcTCGTAGAAAGCTGCTCAGCCTCTCAAGCCCTGGAATGAG
	AACCCAGGCAGCCCCCAGTTCCCTAGATTGAAAACTAGTCCAGATATCTCTTGCTATGAAAGGGGCAGGAAAAGGCGAGGGCGGCGGCAGGGCAGCCTGT
	GAGCCTACCGTGGGCTCAGCTGTGGTCTGTATGGCCCCGGGAGCAAGCCAGCATCTCTGACTGTTGTAAAGACTCTCACCCTTACAACACCGGGACTCCA
	CCTGACCACTTTCCCTGGTTACATACCGTCTCCCACCATGATACTCTCCATGCACACAGGCTTTGCTATGATCCTGGCTCTACAGGATTCACTGGACACT
	GACCCCTCCATAACAagatcagtcagtagagcatgagactcttaat
Exon15 4084677 - 4084819
	GACTATGGCTCAGCACTCCGAGGCCTGTGTGAAGATGCCCTAGAGGGCCTACTGTTCCTGATGCTCTTTTCTCTCCTGTCTGCGGGGGCCCTAGCCACCA
	CTCTGTGCAGCCTGCCCCGCGCCTGGGCCCTCTTCCCACCCAG
Retained Intron 4084820 - 4084958
	GTCAGCAGGGGAGAGAGGGCAGGCTCCCCAGGGAGGGGACAGGAGGCAGTACCCAGGGCCACTGGTGGGGATGGGGCAGCCTCCTGACTCGTTTCCATCC
	TGCTTCTCTGCCACTCCCCACATCCCCATCACACTTCAG
Exon16b 4084959 - 4085004
	TGATGACTACGATGACACAGATGACGATGACCCTTTCAACCCTCAG
Retained Intron 4085005 - 4085264
	GTATCCTGGTGTGAAGGGAGGAGGCCTGGGGCCTGAGCTCCTGGGTCTCTTGGAAGGGGAAATGAGTATTGCATTCTCGGGTCTGAGAAGAAGAGAAATG
	AGACTGGACCTCTGGGTCTGAGGTCCTAGGGGAACAGGGATGAGTCTTGGCCATGAGGGAGGAGGCTGGGGTCTGGAAGCCTGGGCCCGAGGGAGGAGAG
	AAGGGCCCCCACGTACACAACAGATTCTGAGTGTCTTTCCTGCCCTGGTTATCCTGCCAG
Exon17b 4085265 - 4085340
	GAATCCAAACGCTTTGTGCAGTGGCAGTCTTCCATCTGAGCCTCCCCTCCAGTCTGGAGCCTGCCTCTCCTCTATG
Exon18a 4085468 - 4085952
	CTCCTTTCCTGGCTGCTGGAGAAGGCCCCACTAACCTGACCTTGACTGGGCTCTGACCACTAACACTGCTGGCTATGGACATCTCACTTAGGATGGCAAC
	CTGCTCTGGCCCTAACACCCACCCCCCCATCCCCATTTCTCCTTAGCACAGGGGATTGCTGAGGTGGCACAACAGGGACCAGGGGTGGCTGGGAAGGGGG
	CTGACCTATACAGCCTGGTGTTCCTCACCTCTGGCTGCCAGTCCTGTCCTTGGAGGGATGAAGCTGGAGGCAGGTACAGGCACGTCCCTGTTTCCTGCCA
	TACCCCAGCGATCTCAACCTATGGCACTAACTTGGAAGAGGGCTGATTTGAAATAAAAGGGAAGGCTTTATTTTACAAGCAGCTAGGTCCTTCTTATCCA
	CCCCAACTACTGAGAGAAGGAAGTCCTGACTGGGCTAGGGACACTCCTCCTCTGGTGGTTGAAAGGCAACTCTCCTCTTGTCCAG
Exon18b 4085953 - 4088444
	GCTCAGCACTGCATTGCTTCTATAAGTAACATGTGAATCCTGACAAGGGGGAAGAAGCAGATACCGGAAGAGAATAAGCCTAGCACTAAATCTAAACAGG
	CGTGCAGCCACAGGAACAGTCAAGCTTCCAGTCCCGTGGAATGTACAAAGCCTGCTGGGTTTAGGAAAGGCGTGGAATCAACTTGCTTCCTAGCAGCTCA
	CACCCAGCACAAGACTCCAGAAAACCAACGCTTGTATCAGAATAGGGACAGAAGTCTTCGAAGAGAAAGTAGAATATTTGCTTGTAGTGCCACCAGGGTG
	ATATGAAGGGGGAAGGTTTAAGGAAGATATTATAAATCCAGGCAGGAAAAGATGAGGCACTCAATAAGTTATCAAGTAAAAACAAACATGGCAGAGTCAA
	AAGGGAAATTTATTGTCTGGGGAACAATATGTATGTAGTTCTCATTTGTTTAAAAAACAAATAGCATACATGGCAAAGAAAAACGTGGTTAATACATAAA
	CATAATTCAAAAAGCTTCTATTATCTAACAAAAAAGACCTCAATTTAATAATAAGTAACTGAGAAAAACAAAAACCCCAAAACAAATGGATAAAATTGTC
	TTTTTTGTCTTTGTTGttgttgttttggagacagggtttctctgtgaaacagccctgggctgtcctggaactctctttgtagaccaggctggccttgaac
	tcacagagaagagcctgcctcagcctctgcctccctagtgaggagattaacggcgtgtgacggcgtgtatcaccacacccaactAAAGTGTTCAAATTCT
	AATGATTAGCAAACACAATGTGCTACTTTCCCCTTTCGAGTACCTATTTGTTGTGGGATTTAGAGTGGAGTGTGGGCTGGTGCTGGTCTGGAGGCCCAGG
	GAACAGGTTCTCTAAATATGCTGCCCAGAGACTGTGAATCACCAGCTATGTGAAAATAATAATAAACAAAACAAATAAACAAACATAAATATGCTTACAT
	GTGAGAGGATAAAAACTGCATCTCTTATCCTGGTAATCCTTTGAGGGACCAGCTTCCAGAAAGAAATAAACAAGCAACCCCTGGCTCAGTTAAACGCTGG
	AGACAAAACTAATCTGCCACAGTGGGACTCTTCCCAAAGACCAGCAGCTCTGTAGGGGAGATGGCAGAGCAGGGTCCTCAAGTGACTACAGAAGCACCAG
	GGGTATCCCTGGTTCTTGCACAATGCTGGTTTGGATTCCTATGGGTCCTAGTCCTGGCACCTCAGTGTTAATGTAAGCAAGTTATTTGACTCACTGAACC
	TCTTTttttggtttttcaagacagggtttctctgtgtagccctggctgtcctggaactcactctgtagacaaggctggcctcgaactcagaaacccacct
	gcctcttcctcccaagtgctgggattaaaggcgtgggccaccactgcccagttTTTTTTTTTTTTTTTTTGTTGTTGTTGTTGttgttttggtttggttt
	agtttggtttggcttTTTGTTTTGTTTTTTTGAACCTCAGTTGTGTGGTAAAGCAAATGGGCATCATAAACCCAATAAACAGCTCTTGACAGGATGGGta
	aaaaagcaagacaaatgcaacatgatgctctgggttacgctatggcgcaccggaaacattagtgagaaaaagcgcccacatctgcggcttagttcagaat
	attagagcaatgtcaatttcttacttttaacaaatgaatttgaggtgtggaatctagcaataggggaaactgggcatagtgtgcccaattcctgtattac
	ttttgtaatttctgtaaacttaaaatttattctaaaataaaagttcattataaaaaAGAGATGGGAAGAAACCTACCAAGCTAACACTAGCAAATGATAC
	AGAGTTATCCAAGTGTTGTTTAATTACCAAAAGTTGCTTGTACAATGTGAGACTGGAAACTGGTCAATTGATGAACAATAATTGATAAGAAGGTAGTCTT
	ATCAATTATTTTAACGGGAGATCCCAAGTTGGGCTGCATAATTCAATCACTCCTACTGTAAACAGTGAGCTTTAAgtggcggcccacaccttaatcccat
	taagagggaggcgggtttctgagttccagggccatcctgatcctaaaagatacagttcTGCTAGCTGCCACTCCGAGCAGATCTCACCATCCCAACACCC
	TACAAGGTACCTTTCCAGCGTCACAGTCCAGTGGCTACTCCCATTCCTCAAGCGACGCGTTTCCCGCTTCCTTTGGTTCGCACTCGCTGTTCCCTACGCC
	AGGTGCGCCTTTCCAATTTTACTCACTAAATAAACCTTCCAAGGGAGGATTCACCTTATCCCATTTCCCTCCACCCGCTTATATATTCATTTATTTTAAA
	TCGTCCTAGCGCAGTGCGCAGCCTCACAACTCCTGTCCCTATGCGTTACATCTGAGAGACTATTGACTGCTGAGTCAAAACTAAGCTGTTGT

Links between exon parts

From
exon
To
exon
Splice
sites
SupportExamples
12+1ENSMUST00000130150,
24a+72dbEST_BY275226.1,dbEST_BY727801.1,dbEST_CJ179194.1,dbEST_CJ176247.1,REF_NM_001001454.3,REF_NM_001109765.1,REF_NM_021324.5,GB_AK043998.1,GB_AK031550.1,GB_AF190699.1,GB_AK081981.1,GB_AF190991.1,GB_AK048413.1,GB_BC065694.1,GB_AK018148.1,GB_BC046310.1,GB_AB162929.1,GB_AK042758.1,
34a+2dbEST_BY286624.1,ENSMUST00000151959,
4a6+3dbEST_BB639959.1,ENSMUST00000032594,GB_AK042758.1,
4b6+63dbEST_CJ176247.1,dbEST_BB641902.1,dbEST_BB621070.1,dbEST_BY263309.1,REF_NM_001001454.3,REF_NM_001109765.1,REF_NM_021324.5,GB_AK043998.1,GB_AK031550.1,GB_AF190699.1,GB_AK081981.1,GB_AF190991.1,GB_AK048413.1,GB_BC065694.1,GB_AK018148.1,GB_BC046310.1,GB_AB162929.1,GB_AK083126.1,GB_AK049903.1,
4b7+1ENSMUST00000153673,
56+2ENSMUST00000108591,GB_AK015486.1,
67+60dbEST_BY727801.1,dbEST_BB641902.1,dbEST_CF622807.1,dbEST_BB621865.1,REF_NM_001001454.3,REF_NM_001109765.1,REF_NM_021324.5,GB_AK043998.1,GB_AK031550.1,GB_AF190699.1,GB_AK081981.1,GB_AF190991.1,GB_AK048413.1,GB_BC065694.1,GB_AK018148.1,GB_BC046310.1,GB_AB162929.1,GB_AK042758.1,GB_AK083126.1,GB_AK049903.1,GB_AK015486.1,
78+41dbEST_CA318155.1,dbEST_CA319382.1,dbEST_CX240912.1,dbEST_BB653127.1,REF_NM_001001454.3,REF_NM_001109765.1,REF_NM_021324.5,GB_AK043998.1,GB_AK031550.1,GB_AF190699.1,GB_AK081981.1,GB_AF190991.1,GB_AK048413.1,GB_BC065694.1,GB_AK018148.1,GB_BC046310.1,GB_AB162929.1,GB_AK042758.1,GB_AK083126.1,GB_AK049903.1,GB_AK015486.1,
89+44dbEST_CA319382.1,dbEST_CX240912.1,dbEST_BB653127.1,dbEST_BE945513.1,REF_NM_001001454.3,REF_NM_001109765.1,REF_NM_021324.5,GB_AK043998.1,GB_AK031550.1,GB_AF190699.1,GB_AK081981.1,GB_AF190991.1,GB_AK048413.1,GB_BC065694.1,GB_AK018148.1,GB_BC046310.1,GB_AB162929.1,GB_AK042758.1,GB_AK083126.1,GB_AK049903.1,GB_AK015486.1,
910+53dbEST_CA319382.1,dbEST_BB653127.1,dbEST_BE945513.1,dbEST_BY728831.1,REF_NM_001001454.3,REF_NM_001109765.1,REF_NM_021324.5,GB_AK043998.1,GB_AK031550.1,GB_AF190699.1,GB_AK081981.1,GB_AF190991.1,GB_AK048413.1,GB_BC065694.1,GB_AK018148.1,GB_BC046310.1,GB_AB162929.1,GB_AK042758.1,GB_AK083126.1,GB_AK049903.1,GB_AK015486.1,
1011+46dbEST_BY728831.1,dbEST_BU058981.1,dbEST_CX222061.1,dbEST_BU504663.1,REF_NM_001001454.3,REF_NM_001109765.1,REF_NM_021324.5,GB_AK043998.1,GB_AK031550.1,GB_AF190699.1,GB_AK081981.1,GB_AF190991.1,GB_AK048413.1,GB_BC065694.1,GB_AK018148.1,GB_BC046310.1,GB_AB162929.1,GB_AK042758.1,GB_AK083126.1,GB_AK049903.1,GB_AK015486.1,
1112+48dbEST_BU058981.1,dbEST_CX222061.1,dbEST_BU504663.1,dbEST_DN173573.1,REF_NM_001001454.3,REF_NM_001109765.1,REF_NM_021324.5,GB_AK043998.1,GB_AK031550.1,GB_AF190699.1,GB_AK081981.1,GB_AF190991.1,GB_AK048413.1,GB_BC065694.1,GB_AK018148.1,GB_BC046310.1,GB_AB162929.1,GB_AK042758.1,GB_AK083126.1,GB_AK049903.1,GB_AK015486.1,
1214a+47dbEST_BU058981.1,dbEST_CX222061.1,dbEST_BU504663.1,dbEST_DN173573.1,REF_NM_001001454.3,REF_NM_001109765.1,REF_NM_021324.5,GB_AK043998.1,GB_AK031550.1,GB_AF190699.1,GB_AK081981.1,GB_AF190991.1,GB_AK048413.1,GB_BC065694.1,GB_AK018148.1,GB_BC046310.1,GB_AB162929.1,GB_AK042758.1,GB_AK083126.1,GB_AK049903.1,GB_AK015486.1,
1314a+3dbEST_CD350153.1,dbEST_CD355707.1,ENSMUST00000139789,
14a15+48dbEST_BU504663.1,dbEST_DN173573.1,dbEST_CN539644.1,dbEST_BG292799.1,REF_NM_001001454.3,REF_NM_001109765.1,REF_NM_021324.5,GB_AK043998.1,GB_AK031550.1,GB_AF190699.1,GB_AK081981.1,GB_AF190991.1,GB_AK048413.1,GB_BC065694.1,GB_AK018148.1,GB_BC046310.1,GB_AB162929.1,GB_AK042758.1,GB_AK083126.1,GB_AK049903.1,GB_AK015486.1,
1516b+40dbEST_CN539644.1,dbEST_BG297669.1,dbEST_CK623828.1,dbEST_CA750660.1,REF_NM_001109765.1,REF_NM_021324.5,GB_AK043998.1,GB_AF190699.1,GB_AK081981.1,GB_AF190991.1,GB_AK048413.1,GB_AK018148.1,GB_BC046310.1,GB_AK042758.1,GB_AK083126.1,GB_AK049903.1,GB_AK015486.1,
1517b+6dbEST_BI732562.1,ENSMUST00000079415,ENSMUST00000086397,REF_NM_001001454.3,GB_BC065694.1,GB_AB162929.1,
16b17b+42dbEST_BU504663.1,dbEST_BG297669.1,dbEST_CK623828.1,dbEST_CA750660.1,REF_NM_001109765.1,REF_NM_021324.5,GB_AK043998.1,GB_AF190699.1,GB_AK081981.1,GB_AK048413.1,GB_AK018148.1,GB_BC046310.1,GB_AK042758.1,GB_AK083126.1,GB_AK049903.1,GB_AK015486.1,
17b18a+40dbEST_BG297669.1,dbEST_CA750660.1,dbEST_BI732562.1,dbEST_BQ177773.1,REF_NM_001001454.3,REF_NM_021324.5,GB_AK043998.1,GB_AF190699.1,GB_AK081981.1,GB_BC065694.1,GB_AK018148.1,GB_AB162929.1,GB_AK042758.1,GB_AK049903.1,GB_AK015486.1,
17b18b+11dbEST_AA982737.1,dbEST_BB371324.2,dbEST_CF553864.1,ENSMUST00000119661,REF_NM_001109765.1,GB_AK031550.1,GB_AK048413.1,GB_BC046310.1,GB_AK083126.1,