NIA Mouse Gene Index (mm92)

Exon structure for U007929

chr7 +

Exon1 31206748 - 31207514
	TTAGATCGGGGACCCGGCGGCGGCTCCGCGGGGCAGGTAGCGAGGCTGGCGCAACGCCGAGGCCGCGGCCCTGGGGGCCCACAGTCTGCATCCAAGAATC
	CTCGAGGTAAGAGCTGGGGGTAAAGCGAGGAACGCGCCTTTCTGGATGCTTTGAAGGTTGGCTGGAGCGTAAAGCTGGGCCCTGAGAATTGATTCTGGAC
	GTTGAAGAGGAGAGGCTGGGATCCTGGACTTCTGAGTCCTTGGGAGTGTTGGACATCCTTGGGAGTTGGGGTGCAAGGACTGAGAGGCCTGATACCGGGG
	GTTCTCTAAGAGGACGAAGTGACCCGGACTCCTTCACCCAAGGAGGGGCTGCATTGCATCCTTGAAATTGCGGTTATGGACGCAGGTTTGGGCCTCGAAG
	GTCGGGCGCTGGACCTCAGGAGTCCACTCTGGTAGAGAGCAGCCCCGCCCTGGGACTTCCCAGAGCACCACTGGTGCAGGGTGCCCGGGCCGAACAGGAA
	TTCCCCGTGCGCGGGGATTCCACGGGCGCCGCGCTTCGCTGCGTGCCCCGCCTCCGAGCCAGACACCTGCGGCGCGCGCGTGCGGAGCGGAACTGGGAGG
	TGGAAGATTCCCTTGCGTTAGCGCCGTGACGTCAGCGCGCGGCGTCTCGTCTCGAGGGTTTCCGAGTCAGTCCTCGGCTGACTTTAACCCTTCTCGCGCT
	GGAGTCTGAGCTGGGAAGTCTGGGCTGGGGATTTGCTCTTCTTGGGTCGAGGGAACCGGATTTTCAG
Exon2 31208422 - 31208522
	TGAGTCGGCCTGAGCGTAGTCACTGCCCAACACAGACGGTAAAGAAGCTTCTGGAAGAACAGAGGCGCCGACAGCAGCAGCCAGAGGCTGCTGGGGTGCC
	G
Exon3 31208654 - 31208714
	GGACACTTCTCCCCTCCTCTGGTCCAGCCACTGACTCCATCTGTGAATGAGGCAGAGCCAG
Exon4 31209259 - 31209470
	GCCATACTCATTTCCCTGCCTTCCAAGAGACTGTGGATTCCGGACCTGGCAACCTGGCTCCCCCTTCAGGCTTTGCAGACTGGGACCCTAGCATCCATGC
	TACCTATACAGAGGGCTCTTTCCCATTCTCTGCTTCTGAAGGCTTCCTGACTCCTGATTTCTACCCTCCGTCAGACCCAGGCCGGTCAGGCCCATTTCCC
	CTGGTGATGGAG
Exon5 31210241 - 31210428
	GACTCTCTGGATACCCGGCTGTATCCTGAGCCTTCCCTGTCACAGGTAGGGTCCTGGAGAGTCTCTAGTCTCCCCTCAGGATCCCCACAGTTGCCTTCAC
	CCACCGGACCGTCCCTGGAGACAGCCCGAGCTCACATATTGGCTCTGGGGCCCCAACAACTGCTGGCCCAGGATGAGGAAGGAGACAC
Exon6 31210521 - 31210626
	GCTCCTGCACCTGTTTGCTGCCCGGGGGCTGCGCTGGGCAGCATATGCTGCGGCCGAGGTGTTACAGATGTACCGACAGCTGGATATTCGTGAACATAAA
	GGCAAG
Exon7 31210728 - 31210874
	ACGCCGCTCCTGGTGGCAGCTGCTGCCAACCAGCCACTGATTGTGGAAGACCTGCTGAGCCTGGGAGCAGAGCCTAACGCCACTGACCACCAGGGCCGTT
	CCGTCTTGCACGTGGCTGCCACCTATGGACTCCCGGGAGTCCTTTCG
Retained Intron 31210875 - 31210988
	GTATGTCCAGCTGGCAGACCCAGGGTGTCTGGGATGGGCCGGTTATCCAGATCCTGGTTTCCAGGACCATGCTTAGGCAGATCCTTCCACACCCCCTCTT
	CCTTCTCCTCCCAG
Exon8b 31210989 - 31211040
	GCTGTGTTTAAGTCCGGCATTCAAGTGGATCTGGAAGCCAGAGACTTCGAAG
Exon9 31211135 - 31211283
	GCCTTACCCCCCTGCACACAGCCGTCCTGGCCCTCAACGCTGCTATGCTCCCAGCTAGTGTGTGTCCAAGGATGCAGAATTCCCAAGCCCGAGACAGACT
	GACTTGTGTGCAGATGTTACTGCAAATGGGTGCCAGTCATACAAGCCAG
Exon10 31212087 - 31212203
	GAGATCAAGAGCAACAAGACCATTCTGCACTTGGCTGTACAGGCTGCCAACCCCACGCTGGTTCAGCTGCTCCTGGGACTGCCAAGGGGGGACCTGCGGG
	CCTTTGTTAATATGAAG
Exon11 31212445 - 31212609
	GCCCATGGCAACACTGCCCTCCACATGGCAGCCGCCCTGCCCCCTGGGCCGCCCCAAGAGGCCATTGTGCGGCACCTGTTGGCAGCCGGAGCAGACCCGA
	CACTGCGCAACCTGGAGAACGAACAGCCTGTTCACTTGCTGCGACCCGGGCCGGGCCCTGAGGGG
Exon12 31213153 - 31213765
	CTCCGGCAGCTGTTGAAGAGGAGCCGCACGGCACCCCCAGGCTTGTCCTCTTAGGACCGAAACCCAGAACCTGGACTGATTTTCCAGTCCCCACCGTCCC
	GTGGGACAGTCAGCGTATGCTCATGTCGCAGATTCATGATAATATATGTGTAATATCCTGCCATTAGGGTCTTACATTAAAACTCCAAAGTGGCACGGGG
	GGGAGGTGAGCAGTCTCCAATATTTGGGGTCTGTGACACCTCCTCCCCCTACAAGGGGCTTTCTAGGTGATTTCTGTGAAATCGAGCCCACTTGATTGTT
	TCTGTGAAACACTCTAGAGACCTTTAACTTTCTCCTACCTGGATCAGTCATGATCACCCCCCCCAGACTGTCGTACCCTGAATCCCCATTGGAGTTTCCA
	TGGGATTTGAGGCATCTGAGTACCTTTCGGTCAGGATTCCTCCCCAGGACCCACACCCCTGAGATGTTGGAAAGGCCCTCTGAGATTAATGTGTCCTGAG
	TCCTGGCTACATCATCATTTAGAACCCAATGTCTCTGACGCTAGCATTCCCCGTGATTGTTCCCCTTGGTCTGTGTATCCCTGTAGCTACCAATTAAACT
	CAATTTGGCCTCA

Links between exon parts

From
exon
To
exon
Splice
sites
SupportExamples
12-15dbEST_BY214279.1,dbEST_BY222652.1,dbEST_BY211626.1,dbEST_BY222417.1,GB_AK155969.1,
12+3dbEST_BY736841.1,ENSMUST00000108175,GB_AK167356.1,
23+22dbEST_BY214279.1,dbEST_BY222652.1,dbEST_BY222417.1,dbEST_BY750445.1,REF_NM_172142.3,GB_AK155969.1,GB_AK167356.1,GB_AY078069.1,GB_BC110633.1,
34+24dbEST_BY214279.1,dbEST_BY222652.1,dbEST_BY222417.1,dbEST_BY750445.1,REF_NM_172142.3,GB_AK155969.1,GB_AK167356.1,GB_AY078069.1,GB_BC110633.1,
45+16dbEST_BY750445.1,dbEST_BY724506.1,dbEST_DT918814.1,dbEST_DT908813.1,REF_NM_172142.3,GB_AK155969.1,GB_AK167356.1,GB_AY078069.1,GB_BC110633.1,
56+8ENSMUST00000108176,ENSMUST00000108175,ENSMUST00000046177,REF_NM_172142.3,GB_AK155969.1,GB_AK167356.1,GB_AY078069.1,GB_BC110633.1,
67+11dbEST_BE457146.1,dbEST_BE457134.1,ENSMUST00000108176,ENSMUST00000108175,REF_NM_172142.3,GB_AK155969.1,GB_AK167356.1,GB_AY078069.1,GB_BC110633.1,
78b+11dbEST_BE457134.1,dbEST_BF016743.1,dbEST_BF714660.1,ENSMUST00000108176,REF_NM_172142.3,GB_AK155969.1,GB_AK167356.1,GB_AY078069.1,GB_BC110633.1,
8b9+13dbEST_BE457146.1,dbEST_BE457134.1,dbEST_BF016743.1,dbEST_BF714660.1,REF_NM_172142.3,GB_AK155969.1,GB_AK167356.1,GB_AY078069.1,GB_BC110633.1,
910+12dbEST_BE457134.1,dbEST_BF714660.1,dbEST_BU694860.1,dbEST_BU697766.1,REF_NM_172142.3,GB_AK155969.1,GB_AK167356.1,GB_AY078069.1,GB_BC110633.1,
1011+12dbEST_BF714660.1,dbEST_BU694860.1,dbEST_BU697766.1,dbEST_DT927022.1,REF_NM_172142.3,GB_AK155969.1,GB_AK167356.1,GB_AY078069.1,GB_BC110633.1,
1112+10dbEST_BU697766.1,dbEST_DT927022.1,ENSMUST00000108176,ENSMUST00000108175,REF_NM_172142.3,GB_AK155969.1,GB_AK167356.1,GB_AY078069.1,GB_BC110633.1,