NIA Mouse Gene Index (mm92)

Exon structure for U008622

chr7 +

Exon1a 117161752 - 117161972
	ACAGGAAGTGGCCGGAGCATCTCCCGCCTCCACGCCGAGGCGAGAAGGTTCTATCCGGGGCCTTGGCGCTTCTCTTTCCTTTCGCGCCGGTTGCCGCTGC
	GGAGCGCGGCCGGTCCATGTGCGCAGTGAGTGGCGCTATTTCTGCCTCAGTAGCACCGGTGTCCCGGGTCTGACCGACCGCGCGGCGATGGATCCCAACA
	CCATCATCGAGGCCCTCCGGG
Exon1b 117161973 - 117162022
	GCACCATGGACCCAGCCCTGCGCGAGGCCGCTGAGCGCCAGCTCAATGAA
Exon2a 117170585 - 117170662
	GCACACAAGTCTCTGAATTTCGTTTCAACACTGCTCCAGATTACTATGTCAGAACAACTGGATTTACCTGTGAGACAG
Exon2b 117170663 - 117170666
	GCAG
Exon3 117173205 - 117173358
	GTGTTATTTATTTAAAAAATATGATAACACAATATTGGCCTGATCGGGAAGCCACACCAGGGGACATCGCTCCATATACTATTCCAGAAGAAGACCGGCA
	TTGTATTCGAGAAAATATTGTAGAAGCCATTATCCACTCACCTGAGCTTATCAG
Exon4 117175122 - 117175280
	GGTACAGCTTACTACGTGCATCCATCATATCATCAAACATGACTATCCAAGCCGCTGGACTGCCATTGTGGACAAGATTGGCTTTTATCTTCAGTCTGAT
	AACAGTGCTTGTTGGCTGGGAATCCTTCTTTGCCTTTATCAGCTTGTGAAAAATTATGA
Exon5 117180458 - 117180614
	GTACAAGAAACCAGAAGAGCGAAGTCCGTTAGTGGCAGCCATGCAGCACTTTCTGCCAGTTCTGAAGGATCGCTTTATCCAGCTGCTTTCTGACCAATCC
	GACCAGTCTGTCCTCATTCAAAAGCAGATATTCAAGATCTTCTATGCTCTTGTTCAG
Exon6 117182678 - 117182767
	TATACACTACCCCTGGAGCTGATAAACCAACAGAATCTAACTGAATGGGTAGAAATTTTGAAGACAGTTGTGAATAGGGATGTACCTAAT
Exon7 117184120 - 117184214
	GAAACACTTCAAGTTGAAGAAGATGATAGACCTGAGTTACCCTGGTGGAAATGTAAGAAGTGGGCCTTACATATTTTAGCAAGACTTTTTGAAAG
Exon8 117184327 - 117184411
	ATATGGAAGCCCTGGGAATGTTTCTAAGGAGTATAATGAGTTTGCTGAAGTCTTTCTGAAGGCCTTTGCTGTTGGTGTCCAGCAA
Exon9 117185495 - 117185629
	GTTTTATTGAAAGTGTTATATCAGTACAAGGAAAAACAATATATGGCGCCTCGAGTTTTACAGCAGACATTAAATTATATTAATCAAGGAGTTTCCCATG
	CACTTACGTGGAAGAACCTGAAGCCCCATATACAA
Exon10a 117186300 - 117186342
	GGCATTATCCAAGATGTTATTTTTCCATTGATGTGCTATACAG
Exon10b 117186343 - 117186399
	ATGCTGATGAGGAGCTCTGGCAAGAAGATCCTTATGAATATATACGCATGAAGTTCG
Exon11 117187923 - 117187999
	ATGTGTTTGAAGATTTCATTTCTCCTACTACTGCTGCTCAAACACTTTTGTTTACAGCCTGTAGCAAAAGGAAAGAG
Exon12a 117188132 - 117188248
	GTACTGCAAAAGACTATGGGATTTTGTTACCAAATTCTTACTGAACCCAATGCTGATCCTCGGAAAAAAGATGGAGCCTTGCATATGATTGGCTCTTTAG
	CTGAAATACTTCTAAAG
Exon12b 117188249 - 117189675
	GTATTTGTATATGAGTGAGAGaaaaaattatatacttattgatatatttaattttatattatatttacattttatatatttaatCATACATTGTAAATGT
	ATAACTCTATATTATGTTTACATTTAATCATATATTAATATAGATTTCCAtgtgtgttaagtgtagcccatatgtgcagtgcctacctgaagaaaccaga
	gaatactgtatcttgaggtacaggctttgcaaacggctggtgtgggttatcagatctgaacacaggttatctggaagggcagtaaatggttttagctgct
	gagccatcttggcagtcccTAAATTAGTTGCTTGCTCTTTTGTTTTTTGTTTGTTTAGTATAATATGTATACTTTGCAGTCTGTCTATTAGAAGTATACA
	ACTGGCTAATGAACCAACAAACCTTATGGAACTGAGTTAATCCTGGGCTTCTGGTGGTAGGAGAGAGAGGAGAGAGAAATGTAATAAAACGTAATTAAAA
	GTTTTGAGCATTCCTTTTGAGGTTTATGTAGGAATGTATAATTTCATTTTGCATGTATCTAGGAGACTAAATTATTCCCCACAATTTAGACCGCTGAAAA
	ACAGCTTTAATTCCTCTGCATGGTTCTGTGGTTACTTTTTAGTTATTTTGGTTTGATGTGTTTTTTTCTATCTAGCTTCTAACTTGTGATACTTTTATAT
	CTGAACTAGACTTTCCAGTTATACACTATTGTTCCCAGTGTTTCCTTTTTAATTTTGCCATCTTAAGTTAGCATCAGGTTTAATAATCTTTGAACAAGGT
	ACAAGGCTTACACATGTGAGCCACCTTATTCTCCTACAAAGTGTTTTTATGACTAGAGCCATTTTTCTTATGTAACATCTCTCTCTTGAGTTGTTTGTTT
	TTCATGGTTGATCACATGGACACCGAAATGTGCTATTATTAATTTCTTTGGGATTTGAATTAAATTGTATTTCCTGGGAGTGTGGGCAAGTCTTAATGAT
	TCCTGGACATGAGCAccacctcccatgcactgggatcataagcatcacccactgtgcgttttagatgctgatggtcaaactcaagcttaatgcttttact
	aaatccattttcctaattaaactgttgtttcagtctcAAATACATAGACCAGTTTCTTTAGAAACATGGGATGTTTGCTTTCTTATTAGAGAATTCTAAA
	ATGTATAATTGCTGGAACTATGAGGAGGATCAGAGGTGTGATTCATCCTTGCGAAGCAGGCAGTAAAACCATCAGTTCCATGCCAGTCTCAGATCAAAAT
	GCATGTGTTGGATAACATGAGATTTAAGGGATGAGTTTCATTTTGTGTCACGATTAGTCCCTTCTAACATTGTCATGTGTATTTTAATATTATGTTTGAA
	AATGCATCAACTTTTTTATATTCACAG
Exon12c 117189676 - 117189765
	AAAAAGATCTACAAAGATCAAATGGAATACATGTTGCAAAATCATGTATTTCCTCTCTTCAGCAGTGAGCTAGGTTACATGAGAGCAAGG
Exon13 117190192 - 117190357
	GCTTGCTGGGTTCTTCACTATTTTTGTGAAGTGAAGTTCAAAAGTGATCAAAATCTCCAAACAGCTTTAGAGCTGACAAGAAGATGTCTGATTGATGATC
	GAGAAATGCCTGTGAAAGTGGAAGCTGCCATTGCACTACAGGTGTTGATCAGCAATCAAGAAAAAG
Exon14 117190501 - 117190661
	CTAAAGAGTACATCACTCCATTTATCAGACCTGTCATGCAGGCTCTTCTTCATATTATAAGAGAAACAGAAAATGATGATCTTACAAATGTAATTCAGAA
	AATGATCTGTGAATATAGTGAAGAAGTTACTCCTATTGCTGTAGAAATGACACAACATCTG
Exon15 117191643 - 117191771
	GCAATGACATTTAACCAAGTAATCCAGACTGGGCCAGATGAGGAAGGAAGTGATGACAAAGCAGTTACTGCTATGGGAATTCTGAACACAATTGATACAC
	TTCTGAGTGTGGTTGAAGATCACAAAGAG
Exon16 117192308 - 117192374
	ATAACCCAGCAGCTTGAGGGAATCTGCTTACAAGTCATTGGGACCGTTCTACAACAGCATGTCTTAG
Exon17 117192459 - 117192584
	AATTCTATGAGGAGATCTTTTCTTTGGCACATAGTCTGACATGTCAACAAGTGTCTCCTCAGATGTGGCAGTTACTTCCCCTTGTGTTTGAGGTATTTCA
	GCAAGATGGCTTTGATTACTTTACAG
Exon18 117193110 - 117193207
	ACATGATGCCTCTTCTACATAACTATGTAACAGTTGATACAGACACTCTTCTCTCTGATACCAAGTATCTGGAGATGATATACAGTATGTGTAAAAAG
Exon19 117194006 - 117194029
	GAGTGCCGGTGTTCCTTTAGAAAG
Exon20 117194294 - 117194389
	GTTCTTACTGGAGTCGCAGGAGAAGATGCGGAATGCCATGCGGCAAAATTGTTAGAGGTCATTATTCTGCAGTGCAAAGGCCGGGGCATTGATCAG
Exon21a 117194527 - 117194747
	TGTATACCATTATTCGTGGAAGCAGCTTTAGAAAGACTGACCAGAGAGGTTAAAACAAGTGAACTCAGAACAATGTGCCTGCAGGTTGCAATTGCAGCAT
	TGTATTATAATCCACACCTACTGCTTAATACTTTAGAAAATCTTCGCTTCCCAAATAATGTTGAACCTGTTACAAATCATTTTATCACACAATGGCTTAA
	TGACGTTGACTGTTTTCTGGG
Exon21b 117194748 - 117194835
	GTAAGTAACGTTAAATTGTAACTTCATGAGGTGCTGTAAGTAAACACAATAGATAAAAGTAAATTACCATTTTTATTTATTGTTTTAG
Exon21c 117194836 - 117195041
	GCTTCATGACAGGAAGATGTGTGTTCTTGGCCTATGCGCCCTTATTGATATGGAACAAATACCACAGGTTTTAAATCAGGTTTCAGGACAGATTTTGCCA
	GCTTTTATCCTTTTATTTAATGGATTGAAAAGAGCATATGCCTGCCATGCAGAACACGAGAATGACAGTGACGATGATGAGGATGCGGAAGATGATGATG
	AAACTG
Exon22a 117196188 - 117196224
	CAGAACATTTCATTGTCATGAACAACTTAATTGGCAG
Exon22b 117196225 - 117196431
	AAGAACTGGGGAGTGATGAAGATGATATTGATGAAGATGGACAAGAATATTTGGAGATCCTGGCTAAACAAGCTGGTGAGGATGGAGATGATGAAGATTG
	GGAAGAAGATGATGCTGAGGAGACTGCTCTGGAAGGCTATTCCACAATCATCGATGATGAAGACAACCCTGTTGATGAGTATCAAATCTTTAAAGCTATA
	TTTCAAA
Exon23 117197514 - 117197630
	CTATTCAAAATCGCAATCCTGTATGGTATCAGGCTTTGACTCACGGTCTTAATGAAGAGCAAAGGAAACAGTTACAGGACATAGCAACTCTAGCTGATCA
	AAGAAGAGCAGCCCATG
Exon24 117198531 - 117198651
	AGTCCAAAATGATTGAAAAGCATGGAGGATACAAATTCAGTGCACCAGTTGTGCCAAGTTCTTTCAATTTTGGAGGCCCAGCACCGGGGATGAATTGAGT
	TTCCACTTTCTTTCCTGCTGT
Exon25 117199468 - 117200125
	CTCTCAGTGTACAAGTGGACATTTGGATACAAGACCTTATGTAACAAACAGAGGTGATATCTGAAGCATGTAAATTGGATATAAAATTCTACTCTTAAAG
	AGTTGATCTAGAGTATGGCTAAACATCTATATATGCAATCTATTAAAAGAACTTAATTCGGCAATTATGTCTTGATCTGATTGCAATTTATTCCTAATTA
	ATCCTTACCCCCATTAACCTGTTTTTATCTTGTACCAGATAGAGTGCAAAATGTATTTATAAGATTAATACCTGCCCATTCCCCTCTCCTCATTTCTCCT
	CCCCTGTCTTGATTATGGTATCTTATCCTAACTCTGAAGACTGAAGGCACATGGTTCCCTCTAAAAACCACTATTGATACCACTGCAGAAATAAGCCAGC
	AACAACAGGGCAGCGGGGTGGGCTTCTCCCCTCTCTTCCTAAATGCATGTTCAAAGATGAGACCTTATTGATCTTAAACATCTGTCAGATGAGTCATACA
	TTGGATTATTTTTTATATACATGTATACACAATATTTCAAATTGAAAGCAACATCTCAGTGGATTCAAAACTACTACATACTGTTGTCTAAAACAAAATT
	TATAATTGTACAAATGAAATGCACATATTGATATTTAAAATGCATAATTAAGAAAACC

Links between exon parts

From
exon
To
exon
Splice
sites
SupportExamples
1a1b-4dbEST_CA884472.1,dbEST_CA883709.1,NIA_B0105A05-5N,NIA_B0111E01-5N,
1b2a+51dbEST_CJ101383.1,dbEST_CJ101411.1,dbEST_BY234458.1,dbEST_BY231636.1,REF_NM_181517.3,GB_AK039534.1,GB_AK053498.1,GB_AK148820.1,GB_AK079903.1,GB_AK169981.1,GB_BC141510.1,GB_AY316153.1,
2a10b+3dbEST_BY180338.1,dbEST_BY174983.1,GB_AK169981.1,
2b3+44dbEST_CJ186763.1,dbEST_CJ101383.1,dbEST_CJ101411.1,dbEST_BB633518.1,REF_NM_181517.3,GB_AK039534.1,GB_AK053498.1,GB_AK148820.1,GB_AK079903.1,GB_BC141510.1,GB_AY316153.1,
34+37dbEST_BB665089.1,dbEST_CA977712.1,dbEST_BB658683.1,dbEST_BB636322.1,REF_NM_181517.3,GB_AK039534.1,GB_AK053498.1,GB_AK148820.1,GB_AK079903.1,GB_BC141510.1,GB_AY316153.1,
45+24dbEST_CA977712.1,dbEST_BY741840.1,dbEST_BI872500.1,dbEST_CB527236.1,REF_NM_181517.3,GB_AK039534.1,GB_AK148820.1,GB_AK079903.1,GB_BC141510.1,GB_AY316153.1,GB_BC053524.1,
56+23dbEST_CA977712.1,dbEST_CN454978.1,dbEST_CV559059.1,dbEST_BF138711.1,REF_NM_181517.3,GB_AK039534.1,GB_AK053498.1,GB_AK148820.1,GB_AK079903.1,GB_BC141510.1,GB_AY316153.1,GB_BC053524.1,
67+26dbEST_CN454978.1,dbEST_CV559059.1,dbEST_BU055616.1,dbEST_BE571479.1,REF_NM_181517.3,GB_AK039534.1,GB_AK053498.1,GB_AK148820.1,GB_AK079903.1,GB_BC141510.1,GB_AY316153.1,GB_BC053524.1,
78+23dbEST_BU055616.1,dbEST_CA893537.1,dbEST_CV560227.1,dbEST_CD561828.1,REF_NM_181517.3,GB_AK039534.1,GB_AK053498.1,GB_AK148820.1,GB_AK079903.1,GB_BC141510.1,GB_AY316153.1,GB_BC053524.1,
89+22dbEST_CA893537.1,dbEST_CV560227.1,dbEST_CD561828.1,dbEST_CK639596.1,REF_NM_181517.3,GB_AK039534.1,GB_AK053498.1,GB_AK148820.1,GB_AK079903.1,GB_BC141510.1,GB_AY316153.1,GB_BC053524.1,
910b+3dbEST_BY593861.1,dbEST_BY591973.1,GB_AK079903.1,
910a+21dbEST_CV560227.1,dbEST_CD561828.1,dbEST_CK639596.1,dbEST_BB540086.2,REF_NM_181517.3,GB_AK039534.1,GB_AK053498.1,GB_AK148820.1,GB_BC141510.1,GB_AY316153.1,GB_BC053524.1,
10b11+34dbEST_BY174983.1,dbEST_CV560227.1,dbEST_CK639596.1,dbEST_BB540086.2,REF_NM_181517.3,GB_AK039534.1,GB_AK053498.1,GB_AK148820.1,GB_AK079903.1,GB_AK169981.1,GB_BC141510.1,GB_AY316153.1,GB_BC053524.1,GB_BC064825.1,
1112a+29dbEST_BB540086.2,dbEST_CN461624.1,dbEST_BY593861.1,dbEST_BB283155.1,REF_NM_181517.3,GB_AK039534.1,GB_AK053498.1,GB_AK148820.1,GB_AK079903.1,GB_BC141510.1,GB_AY316153.1,GB_BC053524.1,GB_BC064825.1,
12a12c+24dbEST_CN529380.1,dbEST_BQ884900.1,dbEST_CF895479.1,dbEST_BE916382.1,REF_NM_181517.3,GB_AK039534.1,GB_BC141510.1,GB_AY316153.1,GB_BC053524.1,GB_BC064825.1,
12c13+25dbEST_CN529380.1,dbEST_CF895479.1,dbEST_BE916382.1,dbEST_BI688569.1,REF_NM_181517.3,GB_AK039534.1,GB_AK079903.1,GB_BC141510.1,GB_AY316153.1,GB_BC053524.1,GB_BC064825.1,
1314+22dbEST_BE916382.1,dbEST_BI688569.1,dbEST_CO431200.1,dbEST_CA320673.1,REF_NM_181517.3,GB_AK039534.1,GB_AK079903.1,GB_BC141510.1,GB_AY316153.1,GB_BC053524.1,GB_BC064825.1,
1415+31dbEST_CA320673.1,dbEST_CN676174.1,dbEST_CN459338.1,dbEST_CF949766.1,REF_NM_181517.3,GB_AK039534.1,GB_AK079903.1,GB_BC141510.1,GB_AY316153.1,GB_BC053524.1,GB_BC064825.1,
1516+39dbEST_CN676174.1,dbEST_CN459338.1,dbEST_CF949766.1,dbEST_CA947920.1,REF_NM_181517.3,GB_AK039534.1,GB_AK079903.1,GB_BC141510.1,GB_AY316153.1,GB_BC053524.1,GB_BC064825.1,
1617+35dbEST_CN459338.1,dbEST_CF949766.1,dbEST_BB212326.2,dbEST_CA559667.1,REF_NM_181517.3,GB_AK039534.1,GB_AK079903.1,GB_BC141510.1,GB_AY316153.1,GB_BC053524.1,GB_BC064825.1,
1718+29dbEST_CF949766.1,dbEST_CA559488.1,dbEST_CA561389.1,dbEST_CA561363.1,REF_NM_181517.3,GB_AK039534.1,GB_BC141510.1,GB_AY316153.1,GB_BC053524.1,GB_BC064825.1,
1819+2dbEST_CA893538.1,NIA_B0179F12-5N,
1820+25dbEST_CA561363.1,dbEST_CA559769.1,dbEST_BM950064.1,dbEST_CN531882.1,REF_NM_181517.3,GB_AK039534.1,GB_BC141510.1,GB_AY316153.1,GB_BC053524.1,GB_BC064825.1,
1920+2dbEST_CA893538.1,NIA_B0179F12-5N,
2021a+34dbEST_BF133649.1,dbEST_BM950064.1,dbEST_CN531882.1,dbEST_BU922929.1,REF_NM_181517.3,GB_AK039534.1,GB_BC141510.1,GB_AY316153.1,GB_BC053524.1,GB_BC064825.1,GB_AK203124.1,
21a21c+28dbEST_BQ886078.1,dbEST_BI657747.1,dbEST_CF748137.1,dbEST_BB189672.2,REF_NM_181517.3,GB_AK039534.1,GB_BC141510.1,GB_AY316153.1,GB_BC053524.1,GB_BC064825.1,
21c22a+1dbEST_BI104869.1,
21c22b+33dbEST_BQ886078.1,dbEST_BU504463.1,dbEST_CO428509.1,dbEST_CF897574.1,REF_NM_181517.3,GB_AK169981.1,GB_BC141510.1,GB_AY316153.1,GB_BC053524.1,GB_BC064825.1,
22b23+33dbEST_CF748599.1,dbEST_BI104869.1,dbEST_BE569699.1,dbEST_BU519695.1,REF_NM_181517.3,GB_AK169981.1,GB_BC141510.1,GB_AY316153.1,GB_BC053524.1,GB_BC064825.1,
2324+42dbEST_BI104869.1,dbEST_BE569699.1,dbEST_BI872385.1,dbEST_CD805021.1,REF_NM_181517.3,GB_AK169981.1,GB_BC141510.1,GB_AY316153.1,GB_BC053524.1,GB_BC064825.1,
2425+3dbEST_BY387804.1,dbEST_AA536779.1,dbEST_BY384524.1,