NIA Mouse Gene Index (mm92)

Exon structure for U008904

chr7 +

Exon1a 146574983 - 146575082
	CGGGACTTGTCCCAGCCGGAGTCGGCGGCGGCGGCTGCGGGAACTTTCCCGGCGGGTCTAATGGCTGCGCGCGGGCCGCTGTGAggcgcggcggcgagcg
Exon1b 146575083 - 146575144
	ggcgcggggccgcggAGCAGCGAAGAGCCGCGACCGCGAGGCTGGAGCCCCGGCCAGGCCCG
Exon1c 146575145 - 146575363
	GTCCGACCCGCCAAGCCCGCGATGCGCCCCTGTGCTGTCCCCCGGCGCAGCTGACGCCCCGCGGCCCCGCGAGACCCCAGCCCTACCGGCCCCGCAGGAA
	GCGGCCGCCGCCACCCAGTCCAGAGCCCGCTCCGCCCGGGCACCATGGCGGGGAAGGCGGCCGCCCCCGGCACCGCGGTCCTGCTGGTCACGGCCAACGT
	GGGCTCGCTCTTCGACGAC
Exon2 146586388 - 146586645
	GTAACGACCTGGGGCCCTCACTGTTGCAGTCAGGTGGTGTACCCTGTCACTGTCCAGGTGGGAGGAGAGGGCACAAAACAGTACCCTGCTGACAGACTCA
	AGGTTGTCTGAGACCCTTAGGGGGTCAGATGGGTCTCATTTCCCAACTTGCCTCATTTGATGCAGGGGCTTTGGGGTCTCCCAGACCAGCTCGGTGTTAC
	ATTTCATGTGCTTCTGCTGTGTCTTAGCAGAAAGACATGGCCTGGAGAGAGCATGCTG
Exon3 146639953 - 146639994
	CCAGAAAACCTGCAGAAGAACTGGCTTCGGGAATTTTACCAG
Exon4a 146663894 - 146663994
	GTCCTGCACACACACAAGCCTCACTTCATGGCCTTGCACTGCCAAGAATTTGGAGGGAAAAACTACGAGGCCTCCATGTCCCATGTGGACAAATTTGTCA
	A
Exon4b 146663995 - 146664026
	GTAAGTCTCAGCTGGAGCCTGTGGACCGTGGG
Exon5 146667531 - 146667618
	AGAACTACTATCCAGTGACGCAATGAAAGAATACAACAGGGCGCGTGTCTACCTGGATGAAAACTACAAGTCACAGGAACACTTCACG
Exon6 146697307 - 146697370
	GCACTAGGAAGCTTTTATTTTCTTCACGAATCCTTAAAAAACATCTACCAGTTTGACTTTAAAG
Exon7 146702530 - 146702633
	CTAAGAAGTATAAAAAAGTCACTGGCAAGGAGATCTATTCGGACACTTTGGAGAGCACACCCATGCTGGAGAAGGAGAAGTTCCCACAGGACTACTTTCC
	TGAG
Exon8 146709736 - 146709788
	TGCAAATGGTCAAGAAAAGGCTTCATCAGGACGCGGTGGTGCATTGCTGACTG
Exon9 146711561 - 146711680
	TGCCTTCGACTTGGTGAACATTCATCTTTTTCATGATGCATCCAACTTAGTGGCCTGGGAGACAAGCCCCTCAGTGTACTCCGGTGTCAGGCACAAGGCT
	CTGGGCTATGTGCTGGACAG
Exon10 146724078 - 146724162
	AATCATCGACCAGCGATTTGAGAAAGTTTCCTACTTTGTCTTCGGTGATTTCAACTTCCGCCTGGATTCCAAGTCTGTCGTAGAG
Exon11 146744773 - 146744868
	ACACTCTGCACAAAGGCCACAATGCAGACAGTCCGCGCTGCTGATACCAATGAAGTTGTAAAGTTGATATTTCGGGAGTCAGACAATGACCGGAAG
Exon12 146744963 - 146745037
	GTCGTGCTCCAGTTGGAAAAGAAGCTCTTCGACTACTTCAACCAGGATGTCTTCCGGGACAACAACGGCACTGCG
Exon13 146753263 - 146753336
	CTCTTGGAATTTGACAAGGAGTTGTCTGTCTTTAAGGACAGACTGTATGAACTGGACATCTCATTCCCCCCCAG
Exon14 146760843 - 146760954
	CTACCCGTACAGTGAGGACTCCAGCCAGGGAGAACAGTACATGAACACGAGATGCCCTGCTTGGTGTGATCGCATCCTCATGTCCCTGTCTGCCAAGGAG
	CTGGTTCTTAAG
Exon15 146763249 - 146763317
	TCAGAGAGCGAGGAGAAGGTTGCCACCTACGACCACATCGGGCCTAATGTCTGCATGGGAGACCACAAG
Exon16a 146764081 - 146764117
	CCGGTGTTCCTGGCCTTCCGAATCGCACCTGGGGCAG
Exon16b 146764118 - 146764168
	GTAAACCTCACGCCCATGTACACAAGTGTTGTGTCGTGCAGTGACGTGGTG
Exon17 146764253 - 146765551
	GGAAGAGGTGCCAGCGCCGCGAGAGGATCCTCGAGAGGCCTCCCTGTAGCAGTGTATCCAACTCATCCTCCTAACAGCTGCATCGGAACCGCCCAAGCCT
	CACCTGCTAGACGGCCGGCCCCACACTTCGCTTCAGCCTCCGGACCTCCGGAAAGCCTCACATACCTCACTGTCGTGTCTGTCACGTGACATTGTAGACA
	TATTGGGTGTAATCAAGCCACAGTCCTATTGCCAAAACTCTAACAGACAGCAGAGCGCCTGTATTTTAGACTTCACAGTTTTCCATTTTTAACAATTGTC
	TGTGGAGGAAGCTTCTCCATTTAGAGCCCCAGGTGTCCAGCGTCCCTCTCTGCCAGGAGGAGTGTGCCGGGCACTAGCCCAGGCAGCCAGGCTGCCACGT
	GTGCCCAAGCCCGAGGCCCGAGGTCTGACTCTACTGCCATGTTACGTGGCGTGAGAATCACACTGCAGCTGCTTTCCatttttatatatataaatacata
	taaatatatactttttaaaaataatttataaatCTTACCAAAACTTATGCTGAATATACTTTCCAGTATGAGTGCACGAGTGTCCTGAGCAGGCAGAACC
	GCAGTCTAGATGAATGGCGACTCCATCAGCAGTCGGCACCTGTTCCTGAGACAAGGCCTAGCCAGTGCCCAGGGCGAGGGGCCCTGTGATCTGCCTGTAC
	TAGCAGTTTGTCACTCTTCTGCCTTTTCTGTGTAATATTAAGAACTGAATGTGAAGTTTATAGCTAGCCTGGGTGTACCTTTTAAGAATTTTGTAAACTG
	TTTTGTCTGTCTTTTGTTACCGTTTTATGGTGCCAAGTAGCCTACATTAAAACCATAATCTTGTGGGAGAATTAGAAGTAGCCTCGTCCACTTCCCACAG
	ATTGCTTCTAGCATGGGCTGTGTGTAAACCTGGCAGAAAAGCGACGGGTGATGCTGGGCACAGCCTGTTGCCTGGACTAGCACCCAGCACTGAGAACCAC
	GGAAGGCGCCTGCGGAGCCTGCTGAGGAAACACAGCGTGCTTTTATTGATTTACTTCTGAACACTACAGTTCCTGGATGGGGCGGAGGCGCGAGTTAATG
	TCGGTTTCCCTAGAAATCACTCAAGGCCGGCCTGTGTCCTTGATGCCAGGGTCGGGTCTGTGACTGCCATGGTCGCTGCTTGCCAATGTGCCATGTCCGC
	AGCGGTTGTCCGTGGGTTCCAGCTGTGGGTCCTTCCCGTGAAGGCCTCTGGAAGTGACTGCTCGGTTCCTAAGCAATAAAATTGATCATGGTGAAAACA

Links between exon parts

From
exon
To
exon
Splice
sites
SupportExamples
1a1c-1dbEST_BX519452.1,
1a3-0
1c3+20dbEST_BX519452.1,dbEST_BQ179767.1,dbEST_BY749836.1,dbEST_BY731200.1,REF_NM_001127363.1,REF_NM_183144.3,GB_BC056341.1,GB_AK083449.1,GB_AK171360.1,GB_AK171880.1,
23+4dbEST_BY221747.1,dbEST_BY222430.1,ENSMUST00000097975,GB_AK157558.1,
34a+29dbEST_BX519452.1,dbEST_BB644035.1,dbEST_BQ179767.1,dbEST_BY749836.1,REF_NM_001127363.1,REF_NM_183144.3,GB_BC056341.1,GB_AK083449.1,GB_AK171360.1,GB_AK171880.1,GB_AK157558.1,
4a5+24dbEST_BX519452.1,dbEST_BQ179767.1,dbEST_BY749836.1,dbEST_BY731200.1,REF_NM_001127363.1,REF_NM_183144.3,GB_BC056341.1,GB_AK083449.1,GB_AK171360.1,GB_AK171880.1,GB_AK157558.1,
4b5+3dbEST_BB855218.1,dbEST_BB856451.1,ENSMUST00000138183,
56+25dbEST_BQ179767.1,dbEST_BY749836.1,dbEST_BY731200.1,dbEST_BY739401.1,REF_NM_001127363.1,REF_NM_183144.3,GB_BC056341.1,GB_AK083449.1,GB_AK171360.1,GB_AK171880.1,GB_AK157558.1,
67+22dbEST_BY726109.1,dbEST_BE949679.1,dbEST_BE950547.1,dbEST_AW046047.1,REF_NM_001127363.1,REF_NM_183144.3,GB_BC056341.1,GB_AK083449.1,GB_AK171360.1,GB_AK171880.1,GB_AK157558.1,
78+21dbEST_BP765344.1,dbEST_BG918216.1,dbEST_AA839869.1,dbEST_AI118427.1,REF_NM_001127363.1,REF_NM_183144.3,GB_BC056341.1,GB_AK083449.1,GB_AK171360.1,GB_AK171880.1,GB_AK157558.1,
89+24dbEST_BP765344.1,dbEST_BG918216.1,dbEST_AI118427.1,dbEST_CA529745.1,REF_NM_001127363.1,REF_NM_183144.3,GB_BC056341.1,GB_AK083449.1,GB_AK171360.1,GB_AK171880.1,GB_AK157558.1,
910+26dbEST_BP765344.1,dbEST_BG918216.1,dbEST_AI118427.1,dbEST_CA529745.1,REF_NM_001127363.1,REF_NM_183144.3,GB_BC056341.1,GB_AK083449.1,GB_AK171360.1,GB_AK171880.1,GB_AK157558.1,
1011+25dbEST_CF910134.1,dbEST_BY560738.1,dbEST_CF749238.1,dbEST_BX525687.1,REF_NM_001127363.1,REF_NM_183144.3,GB_BC056341.1,GB_AK083449.1,GB_AK171360.1,GB_AK171880.1,GB_AK157558.1,
1112+24dbEST_CF910134.1,dbEST_CF749238.1,dbEST_BX525687.1,dbEST_AA462986.1,REF_NM_001127363.1,REF_NM_183144.3,GB_BC056341.1,GB_AK083449.1,GB_AK171360.1,GB_AK171880.1,GB_AK157558.1,GB_BC055471.1,
1213+27dbEST_CF910134.1,dbEST_CF749238.1,dbEST_BX525687.1,dbEST_AA462986.1,REF_NM_001127363.1,REF_NM_183144.3,GB_BC056341.1,GB_AK083449.1,GB_AK171360.1,GB_AK171880.1,GB_AK157558.1,GB_BC055471.1,
1314+24dbEST_CF749238.1,dbEST_BQ745765.1,dbEST_CX202351.1,dbEST_AA458278.1,REF_NM_001127363.1,REF_NM_183144.3,GB_BC056341.1,GB_AK083449.1,GB_AK171360.1,GB_AK171880.1,GB_AK157558.1,GB_BC055471.1,
1415+23dbEST_CF749238.1,dbEST_CX202351.1,dbEST_BI158100.1,dbEST_BF301326.1,REF_NM_001127363.1,REF_NM_183144.3,GB_BC056341.1,GB_AK083449.1,GB_AK171360.1,GB_AK171880.1,GB_AK157558.1,GB_BC055471.1,
1516a+22dbEST_CX202351.1,dbEST_BI158100.1,dbEST_BF301326.1,dbEST_BQ945601.1,REF_NM_001127363.1,REF_NM_183144.3,GB_BC056341.1,GB_AK083449.1,GB_AK171360.1,GB_AK171880.1,GB_AK157558.1,GB_BC055471.1,
16b17+22dbEST_CX202351.1,dbEST_BI158100.1,dbEST_BF301326.1,dbEST_BQ945601.1,REF_NM_001127363.1,GB_BC056341.1,GB_AK171360.1,GB_AK171880.1,GB_AK157558.1,GB_BC055471.1,