NIA Mouse Gene Index (mm92)

Exon structure for U009148

chr8 +

Exon1 22950351 - 22950491
	AACCCTCACGATTCCTGAGACTTTCAGTCCTGCTGTGGTTACTGACCCTCTCTGGAGTCTGAGTGCCCTTTCTACCAGCCATGAGGACTCTCTGCTCTCT
	GCTGCTGATATGCTGCCTCCTTTTCTCATATACCACTCCAG
Exon2 22953744 - 22953979
	CTGTTGGAAGTTTAAAAAGTATTGGATACGAAGCAGAACTTGACCACTGCCACACCAATGGAGGGTACTGTGTCAGAGCCATTTGTCCTCCTTCTGCCAG
	GCGTCCTGGGAGCTGTTTCCCAGAGAAGAACCCCTGTTGCAAGTACATGAAATGATTAGAAGGAAGCACATGGAAGTCAAGTGACAGATGTGTAATTGAT
	GTTTCAATAAAGGAAACATTTTTTTAAGCTTATCAA

Links between exon parts

From
exon
To
exon
Splice
sites
SupportExamples
12+6dbEST_DV048823.1,ENSMUST00000006745,REF_NM_010030.1,GB_AJ011800.1,GB_BC109129.1,GB_BC109130.1,