NIA Mouse Gene Index (mm92)

Exon structure for U009163

chr8 +

Exon1 23337759 - 23337901
	GTGGTCCCGGCAGCCTGGGAGCGTGCCGGAGCTCTGGACCCGGGCGGGCGTGCAGCTGCGGGACGGGAGATGCTCGGTCAGTCACCCTGTGGCCGCTGAG
	GCTCCCCTCTCACTTCCGCCGTGCCAGACAGACCCGACCCGAG
Exon2 23348927 - 23349069
	GTGCTTTTGGAAAAAAAAAAATCCCACAATTTTGGTGTGAGAAAGGACATGAGGAGACTACAGGCCTGGGATCTTCCCGATCAGAATGAAACCCATGTTG
	AAAGACTTTTCAAATCTCTTGCTGGTGGTGCTCTGTGACTATG
Exon3 23353469 - 23354428
	TCCTCGGAGAAGCCGAATACCTCCTCCTCCAAGAGCCAGTCCATGTGGCACTGAGCGACAGAACGGTGTCAGTGGGTTTCCACTACCTCAGTGACGTCAA
	CGGGACACTGAGGAATGTGTCTGTCATGCTGTGGGAGGCCAACACCAATCGGACTCTTACCACTAAGTACCTCCTGACCAACCAGGCCCAAGGAACACTC
	CAGTTTGAATGTTTCTACTTCAAAGAGGCTGGTGACTACTGGTTTGTAATGATCCCGGAAGTGACAGACAATGGCACGCAAGTTCCACTCTGGGAGAAAA
	GTGCCTTTCTGAAGGTAGAATGGCCTGTCTTTCACATTGATTTAAATAGGACAGCCAAGGCAGCAGAAGGCACCTTTCAAGTGGGTGTTTTTACCACCCA
	ACCGCTCTGCCTGTTTCCCGTGGACAAGCCAGACATGCTGGTGGATGTTATTTTCACTGACCGTCTTCCGGAGGCAAGAGCAAGTTTGGGACAGCCGCTG
	GAGATCAGAGCCAGCAAAAGGACAAAACTCACTCAAGGTCAGTGGGTCGAGTTTGGCTGTGCACCGGTAGGGGTGGAAGCCTACGTTACAGTCATGCTGA
	GGCTGTTGGGTCAAGACTCAGTCATTGCTTCTACGGGACCTATTGACCTGGCTCAAAAATTCGGATACAAATTGATGATGGCACCGGAAGTCACGTGTGA
	GTCTGTGCTGGAGGTGATGGTACTGCCACCTCCTTGTGTCTTCGTCCAAGGAGTCCTGGCTGTTTACAAAGAAGCCCCCAAACGCCCGGAGGAGAGGACT
	TTCCAGGTGGCTGAAAACAGACTGCCCCTGGGAGAGAGGAGAACGGTGTTCAACTGCACTTTATTTGATGTAGGGAAGAACAAATACTGTTTTAACTTTG
	GAATTGTGAAGAAAGGCCATTTTTCTGCAAAGGAATGCATGCTAATTCAGAGAAATATAG
Exon4 23362625 - 23362783
	AAACTTGGGGACCATGGCAGCCGTGGAGCCCGTGTAGCACCACGTGCGGGGATGCTGTCCGAGAGCGTCGCCGCCTGTGTGTCACTTCTTTCCCCTCCAG
	ACCCAGCTGCTCTGGAATGTCCTCAGAGACCTCTCCATGCTCCCTGGAGGAGTGTGCTG
Exon5a 23368764 - 23369356
	TTTTCCGGCCACCAGGCCCATCGCCTGTTTCACCCCAGGACCCTGTGAAGTCCAACAACGTGGTGACCGTCACAGGGATCTCCCTGTGCCTGTTCATCAT
	CTTTGCCACGGTGCTCATCACTCTCTGGAGGAGGTTTGGCCGAGCCCCCAAATGCAGCACGCCCGTTCGCCACAACTCCATCCATTCCCCTGGCTTCCGG
	AAGAACTCCGATGAAGAGAACATCTGCGAGCTGAGTGAGCCTCGCGGAAGCTTCTCGGATGCCGGTGACGGACCTAGGGGAAGCCCAGGGGACACGGGCA
	TCCCATTGACTTACAGGTGCAGTGCATCAGCGCCTCCTGAGGATGAGGCCTCGGGCAGTGAGAGCTTCCAGTCCAACGCTCAGAAGATCATCCCGCCCTT
	GTTTAGCTACCGCCTTGCCCAGCAGCAGCTGAAGGAGATGAAGAAGAAAGGGCTGACCGAGACCACCAAAGTGTACCACGTATCTCAAAGCCCCCTGACA
	GACACTGTAGTGGATGCCACGGCCAGCCCTCCCTTAGACCTGGAATGCCCCGAAGAGGCTGCAGCAAGCAAGTTCCGAATCAAATCTCCATTT
Exon5b 23369357 - 23371806
	CTGGACCAGCCTGGGGCAGGTACCGGGGAAAGGCCTCCCTCCAGGCTGGATGGCATCGTGCCTCCTCCTGGCTGTGCGGTCAGTCCCAGCCAGACCCTGA
	TCCGAAAGTCACAGATAAGGTCGACCGGTGGCAGAGATGGCTCATCGGAGAGGTGCCACTCCAGAAGTTCCCTCTTCAGGAGGACTGCTAGTTTTCATGA
	AACCAAGCAGTCTCGCCCTTTCCGGGAGAGGAGTTTGTCAGCCCTGACTCCCCGCCAGGTCCCCGCCTACAGTTCCAGGATGCGGACCTGGGACCAGATG
	GAGGATAGATGTCGGCCTCCCAGTCGAAGTACCCACCTGCTTCCAGAGAGACCAGAGCACTTCCAAGGGGCAGGTCGGACCAGCAGTCCTTTGGGTCCAC
	TCTCCAAATCCTACACTGTGGGGCATCCCAGGAGGAAACCGGACCCAGGGGATCGTCAGGCCGGATTGGTGGCAGGAGCTGAGAAAATGGAGCCTCACCG
	AGCTCACAGGGGACCGTCCCCCAGTCACAGGAGTGCCTCAAGGAAGCAGTCTTCCCCCATTTTCCTCAAAGATAGCTACCAGAAAGTCAGTCAGCTTAGC
	CCTTCTCACTTCAGAAAAGATAAATGCCAGAGCTTCCCCATCCACCCCGAGTTCGCCTTCTATGACAATACCTCTTTCCGCCTCACCGAGGCTGAGCAGA
	GAATGCTGGACCTCCCAGGATACTTCGGCTCCAACGAAGAGGACGAAACCACAAGTACACTCAGTGTGGAGAAGTTAGTGATCTAGGCTAGGAAGCAGCA
	GGGTTCACCCAGGGTCCTTCACCCCTCTGGCAATATCCCCTGCTCACATACTTTCTGTGGGCTGCACTGTACAACCGTGGGAATTAGTTCACCCAGATTA
	TATGTGTGCGCGCGCATGTGGTTTTGATTAATCAGGAAGAAGTGGTTTATGCTGAATTTTCCTCTCTGTTATCCCTTTTCTATTGGCTTGTTACTACTAA
	TAAAATTTAAAGAAGGCAAATTTATGATGCATTTTGAACACGACACTGGATGTTTCCAACTTAGGACTCTGGGATCTTTTCCCAAGAGGGAGGAGTCTCC
	AAATGGCTGATGTGTATGCAAACCATTATGCGCAGAGCTTGCATCTTGCTTCCTTGTAAAGTAGGAACCAAACACAGGAGCCTAAACATGGGGTTGCTTC
	TTTTGAAGTGTGTTACCAAGGTACCAAGTGGCATAAAGCCTTTCTGCCCAGTGGCCTAAAGACTAATCAGCATACACGTAAATAGCTACAAGCTCAAGGC
	GACCTCCAACAACCACACCCATCCTGCCTTTAGATTGATTTCCTTCTTTTAGAGTTTATCAGGATGTCGGGCAGCTGGGGAGGTTTCAGATAGGGGGAAA
	TCACAAATGTAAACACGGGAGTTTCAAAAGTTCATATTTGTTCAACTGTCACTTGTGACTTTTTGTTTTTAAATTAAAATGTGCTTCCTTTGGAACCGTT
	CTCAGTGATGACTGCCTGCTCTTCAGGAACAGGACGGGTGGATTGTCCAGAGCCCTCTGACAGCTGCTACTCGTGGATGAAAGGAGAGCCAGGCTTGCTA
	CTCTCCAGTTTCTTTATTTATCTCACCAGAAAGCTTTCTTCTTTATCCAAGTTCACAGGCCTGTGGGCCAGCCTTTGACACAGAGGGCACATGATCGCTT
	GTTCCAGACTTCCCAGAGATTTACCCAGCACCGTCAGTCTGAGACCAAAACAGCTTTGGGGAAGTGGGAATTCATGAGGAACACTATGAGCTGAGAGCCT
	TCCTGTTAAGTGATGCTCACTGTCTACCCAGGCCAGTGTTCTGGGGCTGTCACTAACAGTGACACCCCCCCCCCACCTCCGAGGGAGAAAAGATGCTTTA
	TCACAGTTTTTAATGCGTGAGTTATAATTTTCAGTAAACAGATTTTCTGTATCGTACCTCCATGTCTCCATGTTCTAGTCCCGGTATCTGCTATAGAATG
	GAGGCTCAATAAAGACAGTGAGTGGCCAGCTAGTACAATGCCTTTAAACCAGTTGTGGTTGAATTAGAATGATTTTTAATAATACTTTACATTGTAGATC
	ATTATAAAGGAAATGTGTTTATGAGACATTATGAGATTTCAGTTCATACAGGTCTCACAAACATGTTttttgttttgttttattttgttttgttttgttt
	tTTGGTGTCACCAATTCGTGTGTTCCCAATCATCCTGCGAACAATCAGTTATGCTTGGCCAGCGTTTTGCTGGCTCCGTGTTTCAGATTATCTTAGTATA
	TGTAACTTCATGGATCTGGGTAAGCTCGACACACTTAGATGTTTATTGTCTGTGTCCCCACCAGTTGTGACTCCCTGCAATGTGTCTGTGTTCACCTTGC
	TGAAAAGAAGTGTTCTTTCTAAATATAGTTTTTAATCTAAAAATTTAAAA

Links between exon parts

From
exon
To
exon
Splice
sites
SupportExamples
13+4dbEST_BB660601.1,ENSMUST00000162447,REF_NM_001205253.1,GB_AK052555.1,
12+14dbEST_AI787967.1,dbEST_BB652626.1,dbEST_BE288933.1,dbEST_BU053013.1,REF_NM_019576.2,GB_BC029898.1,GB_AK049636.1,GB_BC051957.1,
23+17dbEST_AI787967.1,dbEST_BB652626.1,dbEST_BE288933.1,dbEST_BU053013.1,REF_NM_019576.2,GB_BC029898.1,GB_AK049636.1,GB_BC051957.1,GB_BC119603.2,GB_AB039946.1,
34+10dbEST_BM949188.1,ENSMUST00000069828,ENSMUST00000162447,ENSMUST00000171133,REF_NM_001205253.1,REF_NM_019576.2,GB_AK049636.1,GB_AK052555.1,GB_BC119603.2,GB_AB039946.1,
35a+2ENSMUST00000160585,GB_BC051957.1,
45a+12dbEST_AA168529.1,dbEST_AI509881.1,dbEST_BM949188.1,ENSMUST00000069828,REF_NM_001205253.1,REF_NM_019576.2,GB_AK049636.1,GB_AK052555.1,GB_BC119603.2,GB_AB039946.1,
5a1-1GB_BC051957.1,