NIA Mouse Gene Index (mm92)

Exon structure for U009742

chr8 +

Exon1 107800040 - 107800513
	CTTACCTGTGACAGGCAGATGGAGGAGTCGTGGAAAGGAAAATTAAAAGCACCTAGCAATTAGAAGGTCCAGAGAGGGCTGGACAAGTGAGACTGTGAGC
	TGTACCCACCCCCTGACTCAAATCCGGGTGCTTTGGGACAGGGAAGGGTAGCGGACTATGTGACCACCCCTGCCAGCACGCCTCCACCAGCGTCGCCACC
	AGAGTTCGCAGAGCCAGTGAAGCATGCCCTTCCCCCACGCCATTCCCAGCAGCCCTGGCCGCCCCGCCCCTGTTGCAGCTGCTGTTCGCGTACCCACCCC
	GCTCGCTCGCTCGCTTGGCCCTTTCTGCACTGTCATCTGCCCCGGTGAGGCTCAACTCCGGAGTGGGACTATCCGAAACGCTCCGGACCACAAGCCCGAC
	TCCACCCAGCAGGGAGGGAAAGGAGACAGATTGGGCAGAATCCCAGGCCTCACCACCAGCAGCGGAGTTCGAAG
Exon2 107802871 - 107803170
	CAGAAATGGGCAACGTGCAGGAGCGCCCATCAGAGACCATTGACCGGGAACGGAAACGGCTGGTAGAGACATTGCAGGCTGACTCTGGGCTGCTGCTGGA
	TGCGCTGGTGGCCCGGGGCGTCCTCACTGGGCCCGAGTACGAAGCCTTGGATGCGCTGCCCGATGCAGAGCGCAGGGTGCGCCGCCTACTGCTGTTGGTG
	CAGAGCAAGGGCGAGGCAGCCTGCCAGGAGCTACTGCGCTGTGCCCAGCAAACAGTGCGCATGCCAGACCCGGCCTGGGATTGGCAGCACGTGGGGCCCG
Exon3 107803316 - 107803675
	GCTACCGGAACCGCAGCTATGACCCTTCATGCCCAGGCCACTGGACGCCAGAAGCACCCAGTTCAGGGACCACATGTCCTGAGCTGCCAAGAGCGTCAGA
	GCAAGAGGAGGTCGGAGGTCCTGAGGGCTCTGAGGCACTGCAGCCTCGAACTCCAGAGGAGCCAGAACTAGAAGCTGAAGCTACTGAAGGGGATGAGCCA
	GACCTGGAACAAGAAATGAATCCAGAACAAgagccggagccggagcccgagccagaacccgaacccgagcccgagccggaacccgagcccgagccagaac
	ccgagcccgagccggaacccgaacccgagcccgaCTTCCAAGAAGAGGATGAATCTGAAG
Exon4 107803795 - 107805839
	ATTCCTGAAGGCCAGAATCCTTAGCTGTCCAATCCTATTTGTGCTGGATAAGACCTGGAAACCTGCCAGAGCTTGACCCCATCGATGCACCGAGACACCT
	ACTGCCAAATGAATAAACTCAGGAGGGTCAGTCTGTTCCTGACTCTCCACAAGTCTGGCTCTTTGCTCAAGAACTGAGGGTGAGCGTGGGTCTGAATCCC
	ACTGACCTGAGCAGGCTTGTGTGAAAATACCCCCATCCCCTCAAAAACATTCCACTTCCCAAAGAGCCCAAGCTGTAATTCTGGAGATCTCAGATGCAGG
	CCCCCAAATCTGACCCTCCCTCACCCACTTTATTCCCCTCAGGGGCCATTTGGGAGGCCGAGTGGGCAACACTTCTAATCCATGGAAATCACTCGGCTTG
	GTGTACCAAGCAAGTGAAGGGGGATGTCCATCCACACATGGAGAGAAGTCTTGGCGCTCACAGTCTTGCAGGGAGGACCTGAGAGGAAACTTGAGTAGAC
	AGAAGCCACACACATCattgtaactgctgtttaattgtctggctttcctctgaactgggagctcagtgaggggcgtggggtctaaccagtcacagacata
	cacaaggagctctgcacatatctactaagtaaatgaatACAAACTTCCCAGCTGTGTTTCCAAGCTTCACAGATGGAAACATTAACTGAAAAGCCAGGGT
	TAGGACAGTACTAGCTCACTCTCCCACCGCTGAATCTGAAGTGAAATGAAAGCCTTAACCAGCTCTGTACTAATCCTGGCCTGAACGTGGGATAACAAAC
	CCTAGGGCCTGCCCTGTAGGTTTGATTGTGGTTGCTCCCGCCTGTCCTAACCACTGCCAGAGACCAGCTGTGAGGCTGTGGTTAAAGACAGGCACAACCA
	AGACTAACATGGGGACTGAGGGTGGGACCAGGTGCTGGACTCACAAGACACAAGACACAGTGTGTCTGTGTGAGTGATAAGAAAGGGGGTCTAGggggct
	ggagagatggctcagtggttaagagcactgactgctttcccagaggtcctgagttctactcccagcaaccacatggcggctcacaaccatctgtaatgga
	atctgatgccctcttctagtgtgtctgaagacagctacagtgtactcgtatacataaaataaataagtctttgaaagaaaagaaggaaggaaggaaggaa
	ggaaggaaggaaggaaggaagagagagagagagagggagagggagggagggaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaagagggaga
	gagggaggaaggaaggaaggaagagggagagagggagagggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaaagaaggaaggaaggaag
	gaaggaaggaaggGGTCTAGGAACATACGGTACTTTTCCAAAGGATCCTGCCCCTACATGGAactactactactactactactactactactactactac
	tactactactTCCGGGCCCCGCCTGGAGGCATGAAATGACCCCATGAGGGCGACTATGGAACAATGCATGACCAGTGAGACAGACAGAATGCTGAAAGGC
	AAAGCCCAGCCCAGCTGGGTCTCTGAGCCTGAGTGACAGCCGGAACCCCATGCTCAGGCAAATCACCTCAGAGGGGTTCCCAACTCCTGCTGGCCCCAGT
	GAGAGGTAGAGGTATGAGTGTAGAAGGAGCACCAATCGGCCAGGTAGGGGGAAGGGAAGGAGTGGTACCAGACACCCAAAGCCATCTCATGCAGGAACAA
	GTTTCTATTCCCAAACCAACCCACATTTCTATTCACACTCAGCTCCCATCTCATCGCCCTCCCATCTCCCCTGCTCAGGAGTTTATGTGACATGCTGCTG
	CAGTTCACAGGCCCCAGGAAGGGTAGCAAGGACAAAAACCTTCTAACGTTGCTTCTCATCTGCCCACGATGCTCCTGGCCTCCCAAATGCCCCCAAGAAA
	CACCTAGGCTATGGAACCATAAAGAACTTCATATTCCGATCTGTG

Links between exon parts

From
exon
To
exon
Splice
sites
SupportExamples
12+2dbEST_AW107126.1,dbEST_BX528975.1,
23+18dbEST_AA596110.1,dbEST_AI172771.1,dbEST_AW989895.1,dbEST_AW208576.1,REF_NM_030152.4,GB_AK079536.1,GB_BC027290.1,GB_AY459322.1,GB_AK053846.1,GB_BC053971.1,GB_AK021023.1,
34+20dbEST_AI605452.1,dbEST_AV142120.1,dbEST_AW208576.1,dbEST_AW491983.1,REF_NM_030152.4,GB_AK079536.1,GB_BC027290.1,GB_AY459322.1,GB_AK053846.1,GB_BC053971.1,GB_AK021023.1,