NIA Mouse Gene Index (mm92)

Exon structure for U010637

chr9 +

Exon1 65308741 - 65308961
	GGAAGCGGGAGGCGCGCCCGGGGAGCTCGCAGTACCAAAGCTGGGAGGCGGTGGCCTCTGGCTGCTCGGCCGCGCGCCCCCTCTGCCCGCTGCTCCCGCG
	GGGCTCCTGATCTGCGGCCGCCGGTCCAGTCCGCGCCCCGCCGACTCCATCCTCTGCGCCCAAATCGGGGCGAAGATCCGTCTAGGCTGGAAAGAAAGGG
	ACGCGGGAGCGGCCACGGCAG
Exon2 65310657 - 65310711
	GTGAGTTATACTGAAGACCCGGTAAGGACTACCCTTCGGCCACTGTGGGAAAGAA
Exon3 65313071 - 65313157
	GGTTAACCTCTGCTTCTGCTCATCATGGGAGAGATCAAAGTCTCTCCAGATTATAATTGGTTTAGAAGTACTGTTCCCCTGAAAAAG
Exon4a 65316582 - 65316740
	ATAATCGTGGATGACGATGACAGTAAGATCTGGTCGCTCTACGACGCTGGCCCCAGAAGCATCAGGTGTCCTCTCATCTTTCTTCCTCCTGTCAGCGGAA
	CTGCAGATGTGTTTTTCCAGCAGATTCTGGCTTTGACTGGATGGGGTTACCGGGTTATA
Exon4b 65316741 - 65316743
	GCT
Exon5 65320014 - 65320016
	cct
Exon6 65321445 - 65321525
	TTGCAGTATCCAGTTTATTGGGACCATCTTGAATTCTGTGATGGATTCAGAAAACTTTTAGACCACTTACAACTGGATAAA
Exon7 65323647 - 65323792
	GTTCATCTGTTTGGGGCATCTTTGGGAGGCTTTTTGGCTCAAAAATTTGCTGAATACACTCACAAGTCTCCCAGGGTACACTCCCTCATCCTGTGCAATG
	CCTTCAGTGACACGTCTATCTTCAACCAAACATGGACTGCAAATAG
Exon8 65328186 - 65328294
	CTTCTGGTTGATGCCAGCGTTTATGCTCAAGAAAATCGTTTTGGGGAACTTTTCCTCTGGCCCAGTAGACCCGATGATGGCTGATGCCATTGATTTCATG
	GTGGACAGG
Exon9 65329668 - 65329775
	CTGGAGAGTTTGGGTCAAAGTGAACTGGCTTCAAGGCTAACTCTCAACTGTCAGAATTCCTATGTGGAGCCACATAAGATCCGGGACATCCCCGTCACCA
	TCATGGAT
Exon10 65332249 - 65332389
	GTGTTTGACCAGAGTGCGCTGTCAACAGAAGCCAAGGAAGAAATGTACAAACTGTACCCTAATGCGCGGAGAGCCCACCTTAAGACAGGAGGCAATTTTC
	CCTACCTGTGCAGGAGTGCAGAGGTCAATCTTTATGTGCAG
Exon11 65334640 - 65336277
	ATACATCTGCTGCAGTTCCATGGAACCAAGTACGCTGCCATCGATCCGTCAGTGGTCAGTGCGGAGGAGCTAGAGGTGCAGAAAGGCCGCCTCGGCCTCA
	GCCAGGAAGAGCCATAGATGGGGCTTGAGATGCCGAACCACCCTGCTCTTGCACAATCAGTTCGGGTTCGTTGGTCGGGCACACTGGTCCTCACCCTTCT
	GGAAGTCGGACTGATTGTCAATCTCATGACAGGCGTCAGCTCTTCTAAACCAGTGTGACTGGCCCCTCTCCACATTTGTTTTTGTTTTAAACTTTTAAAT
	TTGAAGAACTTTTAAAGACTCCCATTTTAAGAATTGTGAAAATTTTGCTACCAAAAGTCTTCTCCACTCTGTTCATCTCAAAAGCTTGGGATCATGTGGC
	GTTCTCTCTTTTCCTGCTTTCTATAACTGCTGCACCCACCTCCAGGTTAGAAGAGGAGCACCGGTCATTTTTATGCTTTCTTGGGCATAACCAGAGGGTC
	GAGGCTGGCAGCCTGCTGGCCACTCCCTACACATCAGCTTTTTTGCTTTCCAGTTGAGCACATCATTTTGAGTATTAGCTGTTGTATTTCTAGACATTAC
	ATTTGGAATAAAAATTGAATTTCAGCCAGTGGCTTCTGTGATGAGTGAGGCTGCCCCTCTGGGCTACTGGCCAGTGCTGTGTGATGTCGGGTGAACAAGT
	CCATCACTCTGACTGCAGCACGGCTGGCTGTTACCTGCTGACTGCCGCTGTAGCCTACGTGCTCTTTTAATCTTTTTCACTAATGGGATTGTTAAAAAAg
	agatagagtctcatttaggctaggctggccttgaactcattatgtgtcagggctagcttagagctcctgatccccctgcctccacctcccaagtgctagg
	attacagatgttatcctgaaagatcaccagatgcccgatagaagtggtTTTAATACATATGGAGAACATAGTAAACTGTCTCCAGCTCTTGATCCAATGT
	AGAAAACGTCCAGCCTGTGGATAGCCTTGTCTCCCTCCCGCACTTTTCTACATCCCTTCCTATCCTGGATGGCTATAAAGCATTTCCATGTGTCCTTTCA
	AGAGATATGATAGGATACTTGAGACgctggggagatgagtctgtgagtaaaagtgcgtgctggacgagcatgagcacttgagaccgcccagtgcccgtgc
	acagtgtcaagagtgtccaggcagcctgtaacctcagATAGCCCAGTGCCCGTGCACAGAGTCAAGAGTGTCTAGGCAGCCTGTAACCTCAGATAGCCCA
	GTGCTCGTGCACAGTGTCAAGAGTGTCCAGGCAGCCTGTAACCTCAGATAGCCCAGTGCCCGTGCACAGTGTCAAGAGTGTCCAGGCAGCCTGTAACCTC
	AGATAGCCCAGTGCCCGTGCACAGTGTCAAGAGTGTCCACATAGCCTGTAACCTCAGATAGCCCAGTGCCCGTGCACAGTGTCAAGAGTATCCACACAGC
	CTGTAACCTCAACACTAGCTGCAGGGCATCCATTCTCTGGCATCTGCCCACACATACACAGATATATACACCCATCTGTATACAGGTATCTATACAGTAA
	CAAAGAGGTTATTTGATAATAAAGGTTGAAATATCTGT

Links between exon parts

From
exon
To
exon
Splice
sites
SupportExamples
13+80dbEST_BY294615.1,dbEST_BY045759.1,dbEST_BY043563.1,dbEST_BY059239.1,REF_NM_138584.2,GB_AK150215.1,GB_AK009332.1,GB_AK170666.1,GB_AK090017.1,GB_AK150581.1,GB_BC132377.1,GB_BC132403.1,GB_AK149930.1,GB_AK011985.1,GB_AK153284.1,
23+5dbEST_AA050516.1,dbEST_AA051527.1,dbEST_AA008232.1,dbEST_BY105897.1,
34a+90dbEST_BY294615.1,dbEST_BY045759.1,dbEST_BY043563.1,dbEST_BY059239.1,REF_NM_138584.2,GB_AK150215.1,GB_AK009332.1,GB_AK170666.1,GB_AK090017.1,GB_AK150581.1,GB_BC132377.1,GB_BC132403.1,GB_AK149930.1,GB_AK011985.1,GB_AK153284.1,GB_BC099434.1,
4a5+1dbEST_BY062074.1,
4b6+59dbEST_CJ134842.1,dbEST_BY709106.1,dbEST_BU842005.1,dbEST_BY733047.1,REF_NM_138584.2,GB_AK150215.1,GB_AK009332.1,GB_AK170666.1,GB_AK090017.1,GB_AK150581.1,GB_BC132377.1,GB_BC132403.1,GB_AK149930.1,GB_AK011985.1,GB_AK153284.1,GB_BC099434.1,
56+1dbEST_BY062074.1,
67+64dbEST_CJ134842.1,dbEST_BY709106.1,dbEST_BU842005.1,dbEST_BY733047.1,REF_NM_138584.2,GB_AK150215.1,GB_AK009332.1,GB_AK170666.1,GB_AK090017.1,GB_AK150581.1,GB_BC132377.1,GB_BC132403.1,GB_AK149930.1,GB_AK011985.1,GB_AK153284.1,GB_BC099434.1,GB_AK187235.1,GB_AK199934.1,
78+35dbEST_BY709106.1,dbEST_BU560786.1,dbEST_BY711180.1,dbEST_BE951289.1,REF_NM_138584.2,GB_AK150215.1,GB_AK009332.1,GB_AK170666.1,GB_AK150581.1,GB_BC132377.1,GB_AK149930.1,GB_AK011985.1,GB_AK153284.1,GB_BC099434.1,GB_AK187404.1,
89+51dbEST_BY709106.1,dbEST_BY711180.1,dbEST_BE952036.1,dbEST_BQ899588.1,REF_NM_138584.2,GB_AK150215.1,GB_AK009332.1,GB_AK170666.1,GB_AK090017.1,GB_AK150581.1,GB_BC132377.1,GB_BC132403.1,GB_AK149930.1,GB_AK011985.1,GB_AK153284.1,GB_BC099434.1,GB_AK209522.1,GB_AK211454.1,GB_AK217468.1,GB_AK218378.1,GB_AK210536.1,GB_AK187404.1,
910+45dbEST_BQ899588.1,dbEST_CK020538.1,dbEST_CX206747.1,dbEST_CX734026.1,REF_NM_138584.2,GB_AK150215.1,GB_AK009332.1,GB_AK170666.1,GB_AK090017.1,GB_AK150581.1,GB_BC132377.1,GB_BC132403.1,GB_AK149930.1,GB_AK011985.1,GB_AK153284.1,GB_BC099434.1,GB_AK187404.1,
1011+43dbEST_CX206747.1,dbEST_CO430365.1,dbEST_BE854112.1,dbEST_BI904243.1,REF_NM_138584.2,GB_AK150215.1,GB_AK009332.1,GB_AK170666.1,GB_AK150581.1,GB_BC132377.1,GB_BC132403.1,GB_AK149930.1,GB_AK011985.1,GB_AK153284.1,GB_BC099434.1,GB_AK219439.1,