NIA Mouse Gene Index (mm92)

Exon structure for U011699

chr10 +

Exon1a 77888414 - 77888562
	TGTCACGTGCTACGGGTCCGGGGGGGCGGAGCCAAGCCAGGTTTTTCTAGGGTCCAGGCACCCAGGTCTCCTAGTTGGATCTGTCTTCAGCTTCTCCGTG
	CTACCCCGACTACTGCTGCCAAGATGATGTGTGGCGCGCCATCTGCCAC
Exon1b 77888563 - 77888602
	AATGCCAGCCACGGCCGAGACGCAGGAGGTCGCCGACCAG
Exon2 77889672 - 77889773
	GTGAAGTCCCAGCTTGAATCGAAAGAAAATCAGAAGTTTGATGTCTTTAAAGCCATATCCTTCAAGAGACAGATAGTGGCTGGCACCAACCTCTTCATCA
	AG
Exon3 77890056 - 77890371
	GTTGATGTTGGTGGAGATAAATGCGTGCACTTGAGGGTGTTTCAACCCCTCCCCCATGAAAACAAGCCTTTGACCCTGTCTTCCTATCAGACCAACAAAG
	AAAGGCACGATGAGCTCTCCTACTTCTGATTCGGGGCTCCTTTGCACCTGTGTTTGGGACCACGTAGTAAAACCCCCCTCGGTGATGGAGAGAAGGGAGT
	TGAGCAGCTTCTGTTGTGATTCTCAAACTGCGTTGTATTTTGCATCCTTCCAAATAATTATTTTCAGAAAACTGTATATGATCTCTCTAAATATATATTT
	TTAGAGACTATATGAA

Links between exon parts

From
exon
To
exon
Splice
sites
SupportExamples
1a1b-0
1b2+188dbEST_AA014361.1,dbEST_BY090522.1,dbEST_BY085914.1,dbEST_BY091749.1,REF_NM_007793.3,GB_AK002403.1,GB_BC056170.1,GB_AK151205.1,
23+222dbEST_AA014361.1,dbEST_BY090522.1,dbEST_BY085914.1,dbEST_BY091749.1,REF_NM_007793.3,GB_AK002403.1,GB_BC056170.1,GB_AK151205.1,