NIA Mouse Gene Index (mm92)

Exon structure for U011817

chr10 +

Exon1 83006497 - 83006847
	AAAGAGCCTCGAGGAACGGAATGTGCCCTGAGAACAGTCGTGAACGGCAGCGAGACCAGGAAAGGATGCAGGATGCCAACGGCAGCCATCACTATGGCGG
	CCGCGCCGGGAGCAGGCGGTCGACTCGCTTTCCCAGCGGCTCCCGCGGTCCGCAGGGCCGAGAGTCCACTGGCTCTGGCGTGCGGGGGCGGGGCCGAAGC
	CGGAAGTCACGTGCCGTGACAGCGGCTGGGGTGAGGCCCGCGTCGCGGCTGTGGCTGCTCGGGGCTGTGTCTGTGGGAGGTTCCGCGGCGATGGCCGTGG
	ACACTCTGTCGCCCGACTGGGACTTCGACCGCGTGGACGACGGCTCTCAGA
Exon2 83009530 - 83009669
	AAATTCATGCTGAAGTCCAGCTGAAGAACTACGGGAGGTTCCTTGAGGAGTACACATCTCAGCTGAGAAGAATTGAGGACGCCCTAGATGATTTGATTGG
	CGATGTTTGGGATTTCAATCTTGATCCTATAGCATTAAAG
Exon3 83012207 - 83012260
	CTTCTGCCCTATGAGCAGTCTTCCCTTTTGGAACTCATAAAGACTGAAAACAAG
Exon4 83012344 - 83012409
	GTCCTGAACAAAGTCATCACTGTTTATGCGGCACTTTGTTGCGAGATCAAGAAATTAAAATATGAG
Exon5 83013009 - 83013054
	GCAGAAACTAAGTTTTACAATGGTCTTCTGTTTTATGGTGAAGGAG
Exon6 83013626 - 83013693
	CTACAGATTCCAGCATGGTGGAAGGTGACTGCCAAATTCAAATGGGGAGATTCGTTTCATTCTTACAG
Exon7 83017479 - 83017561
	GAACTGTCCTGCTTTGTGACGAGGTGCTACGAAGTGGTGATGAATGTCATCCACCAGCTGGCTGCCCTGTACATCAGCAACAA
Exon8 83018318 - 83018360
	GATAGGACCCAAAATTATAGAGACAACTGGAGTTCATTTTCAG
Exon9 83018746 - 83018861
	GTTTTTTGACAGACTATGTATGAGCACTTGGGAGAACTGCTAACAGTTTTACTTACCCTGGATGAGATTGTTGATAATCATGTCACGCTGAAAGACCACT
	GGACTATGTACAAAAG
Exon10 83019548 - 83019668
	GTTGCTGAAATCTGTCCATCACAACCCTTCAAAATTTGGGATTCAGGAAGAAAAGTTAAAGCCCTTTGAGAAGTTCTTGCTGAAGCTGGAAGGGCAGTTA
	CTTGATGGAATGATATTTCAG
Exon11 83021343 - 83021466
	GCCTGTATCGAACAGCAGTTTGATTCTCTCAATGGAGGAATATCTGTGTCGAAAAATAGCACGTTTGCAGAAGAGTTTGCACATAGCATTCGCTCAATTT
	TTGCAAATGTGGAAGCCAAGCTTG
Exon12 83021563 - 83021690
	GTGAGCCTTCTGAAATTGACCAGAGAGACAAGTATGTTGGAATTTGTGGGCTCTTTGTACTGCACTTTCAGATTTTTCGGACTGTTGATAAAAAGTTTTA
	TAAGTCTTTATTGGACATTTGTAAGAAG
Exon13 83023111 - 83023271
	GTGCCAGCCATCACTTTAACTGCTAATATTATTTGGTTTCCTGATAATTTTCTGATTCATAAAATGCCAGCAGCTGCCAAACTTCTAGACAGAAAAAGTC
	TTCAAGCCATTAAAATACACAGGGATACCTTCCTACAGCAGAAAGCTCAGTCACTTAACAA
Exon14 83027156 - 83027282
	AGATGTGCAGTCTTACTACGTCTTTGTGAGCTCATGGATGATGAAGATGGAGTCTATGTTATCTAAAGAGCAGAGGATGGATACATTTGCTGAAGACCTC
	ACCAACAGATGCAATGTTTTCATACAG
Exon15 83032713 - 83032838
	GGTTTCTTATATGCATATAGTATTAGTACCATTATTAAGACCACAATGAATCTCTACATGTCCATGCAGAAGCCTATGACCAAAACTTCAGTGAAGGCAT
	TATGCAGGCTCATTGAACTTCTCAAG
Exon16 83034098 - 83034205
	GCAATAGAGCATATGTTCTACAGGAGAAGCATGGTTGTGGCGGATTCGGTGTCACATATAACACAGCACCTTCAACATCAGGCTCTTAGTTCTATTTCTG
	TAGCCAAG
Exon17 83034838 - 83034984
	AAAAGAGTAATTTCAGACAAAAAATATAGTGAACAGCGTCTTGATGTGCTATCTGCTCTTGTTTTGGCTGAAAACACCTTAAATGGACCAAGCACAAAAC
	AACGACGACTTATTGTTTCTTTGGCATTGAGCGTTGGCACGCAAATG
Exon18 83035103 - 83035182
	AAAACATTTAAAGATGAAGAACTCTTTCCCCTTCAAGTAGTCATGAAGAAGCTGGATCTTATCAGCGAGCTTAGAGAGCG
Exon19 83036521 - 83036626
	AGTCCAAGCACAGTGTGACTGCTGTTTTTTATACTGGCATCGCGCTGTCTTCCCGATTTATTTAGATGATGTATATGAAAATGCTGTCGATGCAGCCAGA
	TTACAT
Exon20 83037188 - 83037304
	TACATGTTCAGTGCTTTACGAGACTGTGTGCCTGCCATGATGCATTCAAGGCATTTAGAGTCCCATGAGCTGCTTTTGGATTGCTATGACAAGGAAATCA
	TGGACATTTTAAATGAG
Exon21 83038762 - 83038930
	CATTTGCTGGATAAGCTGTGTAAGGAGATCGAGAAGGACTTGCGGCTTTCTGTGCATACTCACTTGAAGCTGGATGACCGGAACCCCTTCAAAGTTGGCA
	GGAAAGACTTGGCGCTCTTTTTCTCTCTGAACCCTATTCGGTTTTTCAATCGATTCATTGATATTCGAG
Exon22 83039420 - 83039574
	CTTATGTAACTCACTATCTGGATAAGACTTTCTACAATCTCACAACAGTAGCTCTTCATGATTGGGCCACTTACAGTGAAATGAGAAATCTGGCTACGCA
	GCGTTATGGTTTGGTTATGACAGAGGCACATCTTCCTAGCCAGACTTTGGAGCAG
Exon23 83042227 - 83042301
	GGACTCGATGTCCTGGAAATTATGAGAAACATTCACATATTTGTCTCAAGATACCTCTATAATCTCAATAACCAG
Exon24 83043002 - 83043106
	ATTTTTATTGAACGGACAAGCAACAATAAACATTTGAATACTATTAATATTCGACACATTGCTAATTCGATTCGAACACATGGGACGGGGATCATGAATA
	CAACA
Exon25 83044002 - 83044136
	GTTAATTTCACGTACCAGTTTTTGAAAAAGAAGTTCTATATATTTAGTCAGTTTATGTATGATGAGCATATCAAATCCAGATTGATTAAAGATATTCGGT
	TTTTCAGGGAGATCAAGGACCAAAATGACCACAAG
Exon26 83046000 - 83046108
	TATCCTTTTGATAGAGCAGAAAAATTCAATCGTGGCATAAGAAAACTTGGAATCACACCAGAGGGACAGAGCTACCTTGACCAGTTCAGGCAGCTCATCA
	GCCAGATTG
Exon27 83048563 - 83048629
	GTAATGCTATGGGCTATATACGCATGATAAGATCTGGTGGTCTTCATTGTAGCAGCAATGCCATTAG
Exon28 83049379 - 83049465
	ATTCGTGCCGGATCTTGAAGACATTGTGAGTTTTGAAGAGCTCGTGAAAGAAGAAGGGCTTGCAGAAGAAACACTTAGAGCAGCCAG
Exon29 83050902 - 83051049
	GCATTTGGACTCAGTCCTCAGTGATCATACACGGAACTCTGCTGAAGGTACAGAATATTTCAAAATGCTTGTAGATGTTTTTGCTCCAGAATTTCGAAGG
	CCAAAGAATATACATCTCCGAAATTTCTATATCATTGTTCCTCCTCTT
Exon30 83053036 - 83053132
	ACTCTGAACTTTGTAGAACATTCTATAAGTTGCAAAGAGAAGTTGAATAAAAAAAATAAACTAGGAGCTGCATTTACTGACGATGGTTTTGCCATGG
Exon31 83053732 - 83053928
	GTGTGGCTTATACCTTAAAGCTTTTGGATCAGTACCAAGAGTTTGATTCACTTCATTGGTTCCAGTCTGTTAGAGAAAAATACATAAAGGAGATCAGAGC
	AGTTGCTAAGCAACAGAACGTGCAGTCAACTAGTCAAGATGAAAAACTACTCCAAACCATGAACCTTACTCAGAAGCGACTGGAGGTCTATTTACAG
Exon32 83054434 - 83054533
	GAATTTGAGCTGCTGTATTTCTCCTTGAGCAGTGCAAGAATATTCTTCAGAGCAGACAAGACCGCAGCTGAAGAGAACCAAGAAAAGAAAGAGAAGGAAG
Exon33 83056916 - 83059218
	AAGAAACTAAAACAAGCAATGGAGATGGACCCGAGAGCACTGTGTCTGCAGATCCCGTGGTGAAATGATGGTGTGCAGTCGTCAGACGTATCATGATGCT
	TTTCCAGAGACATGGATGCTATGGCGTGCTTGATAAGTTGTCATTTCCCAGGTCACACCTAAGGAGACTGTACGGACTGCTCTGGCTCTGGAGTCAAGTC
	CACTTTATTTCTGATGCTCCAGCTTTCAAGGGCCGAGAAGCAAACGGTAAGACTGGATCTTTGGAGTGTAGGCTGAAGGCGCCCCTGTGAAACTGCCATG
	AAGCTGGCGAAGGGCAAGTCCAGATCCCTAACCCATCGCCTCCCTTCCCTGTACTCTGTGTGTGTTTGTAATTTGTCTGTGTCTTTGATTCATGTTGATC
	TCAAGTCATGGGAAAGTCAGTGCATATGCGGTACACAGCCAGTAAATAACGCAGTTAAAAAGAGTTGAGCCTGAAAGTCATGAAGCATCTGTATCAGAGA
	CTGTGTGAGGATGCTAGACATGAGCAGACTGTTACTGCCTGTGCACAGCGTGGCCAGCTGGTGATCCTTCCTGTGTTGTTGGATTCCACGTGACTCACAT
	GAGCTGCTGATGTCTTTGGTGAGACATTTTATAATAGTTTACATTGCTTTGGGAACATTTATCCTCCAACAATTGCTTTAAATTTAAGATTTAATACTCA
	AAGAAAACTCAGATTAAGCCATAGACGGGACCCACTTGACATTTCACTAGGTTTGAAGGCACTCTGTGATACTAGGGAAGAAAAGAATGAACTATCTACA
	GCCAAACTCAGGTTTCTTCATTACTTTAAATTGAAATCTTGGTGGCAGTTTAGACAGAATTTTACTTTAAATCAAGTATAATCTAAGATATAAGATTAAA
	TAATAACTGCACTATGACAGGTGTTCAGAAATATACCACTGTGAGAATGAAACTAGTTAAGTCACTTACTGATTTTAAAAGAATGAAAGACTTTGAGCAA
	ATTTAGTTCCCAACAAGCTACTAGCTTTATTTTTGTAAAGGTATGCTAGCTGATAGTTAAATGGATTAATCATGGCCTTTTTTGAACGTATACTAAAATG
	ATGCCTTTGGGATGGAAAGGAAGGTTTAGAACTTTAAATATAATACAGACCTTTTTTGGGAATTGCTTGTTTTTTATTGCATTTACCTGCTTAACCATTT
	CTTTGGATACATCTTGCATGTAATCCTAACACTTAGAATTCTGACATTCTTCCTTGGTTCCCGCTTTTGGAGTGGAGATACAGTGCCCAACCTAGACTCA
	GTGGTTGCGGTCAGGGCAACTGTCTCAGCCCAAGCTAAATACTTTGACTGTTAAGTCAGAAGAAACAGAATAGATTGGAAATGGTTTTTATTATATAAAC
	ATGGCTTATAGAATTATGAACAAAGAATGGATTAAAGGCATTTAATGTTTGTAATTGATACTAACTGTAGAGATGGCCCTAAAGCATGCTGCataattaa
	taatttatattttcattattataaatgtttatattaatGATACTGGATTTGATTATATCAAATTAGTCACCATTTTATAGTACCAATATTTCTGTCTTTT
	TCTTAAAAATGTTCTTTAATTATTCCTGAACATGAGAGTTCACATATTCCTTGGACACTTAAAATGGGAAGTGACAGGTAACTGTTTTAACTTTAGTTAA
	AAATAATGTCACTggggctggtgagatggctcagtgggtaagagcacccgactgctcttccgaaggtccagagttcaaatcccagcaaccacatggtggc
	tcacaaccatctgtaacaagatctgacgccctcttctggagtgtctgaagacagctacagtgtacttacatataataaataaataaatctttaaaaaaaa
	aaaaaaTAATGTCACTGTAGTCTGGATAAATTATAATAAGTTCATGTATTTGAAATAAAGTCTCTGATGAGAGAAATATTTAAATGGTATTAAACTGCTG
	AGCAACAGGGCTTCAGTATGTTCACACCTGGGTTACTGTATACGTTGGATGATGGTTTTCTTTTGCTAACAATATTTTTTCAGAAATATTGTAATTTAAA
	TATTAACATGAGTGTTTTGTTGTAAATTCACAGAAAACTTAATGATGTTCAAATTCTCAGGAATTAAGAACTAACCATAACATTGTCAGTTCTGATTAAA
	TTTTGTAAAAGACAGCAAGTTTGTTATCTCACTTGAGTGGGGTTCTCCTTTCCCTTGGCTCAAATAGAATACAATACGTATAATAAAGCATTAATAAATA
	TAA

Links between exon parts

From
exon
To
exon
Splice
sites
SupportExamples
12+42dbEST_BQ561687.1,dbEST_CA569816.1,dbEST_BY022238.1,dbEST_BY734746.1,REF_NM_001033375.2,GB_BC145215.1,GB_AK145000.1,GB_AK166233.1,GB_AK043911.1,GB_AK038582.1,
23+48dbEST_BQ561687.1,dbEST_CA569816.1,dbEST_BY022238.1,dbEST_BY734746.1,REF_NM_001033375.2,GB_BC145215.1,GB_AK145000.1,GB_AK166233.1,GB_AK043911.1,GB_AK038582.1,
34+42dbEST_BQ561687.1,dbEST_CA569816.1,dbEST_BY022238.1,dbEST_BY734746.1,REF_NM_001033375.2,GB_BC145215.1,GB_AK145000.1,GB_AK166233.1,GB_AK043911.1,GB_AK038582.1,
45+35dbEST_BQ561687.1,dbEST_CA569816.1,dbEST_BY734746.1,dbEST_CJ111096.1,REF_NM_001033375.2,GB_BC145215.1,GB_AK145000.1,GB_AK166233.1,GB_AK043911.1,GB_AK038582.1,GB_BC020314.2,
56+29dbEST_CA569816.1,dbEST_BY734746.1,dbEST_CJ118822.1,dbEST_CD549294.1,REF_NM_001033375.2,GB_AK145000.1,GB_AK166233.1,GB_AK043911.1,GB_AK038582.1,GB_BC020314.2,
67+22dbEST_BY734746.1,dbEST_CD545070.1,dbEST_BY752537.1,dbEST_BB632415.1,REF_NM_001033375.2,GB_BC145215.1,GB_AK145000.1,GB_AK166233.1,GB_AK043911.1,GB_AK038582.1,GB_BC020314.2,GB_AK129269.1,
78+17dbEST_BB632415.1,dbEST_CN681141.1,dbEST_CV556330.1,dbEST_AV581783.1,REF_NM_001033375.2,GB_BC145215.1,GB_AK145000.1,GB_AK166233.1,GB_AK043911.1,GB_AK038582.1,GB_BC020314.2,GB_AK129269.1,
89+2dbEST_CO045006.1,GB_BC145215.1,
910+15dbEST_CV556330.1,dbEST_CA947890.1,dbEST_CO045006.1,dbEST_CN534943.1,REF_NM_001033375.2,GB_BC145215.1,GB_AK145000.1,GB_AK166233.1,GB_AK043911.1,GB_AK038582.1,GB_BC020314.2,GB_AK129269.1,
1011+14dbEST_CV556330.1,dbEST_CO045006.1,dbEST_CN534943.1,dbEST_BP761731.1,REF_NM_001033375.2,GB_BC145215.1,GB_AK145000.1,GB_AK166233.1,GB_AK043911.1,GB_AK038582.1,GB_BC020314.2,GB_AK129269.1,
1112+19dbEST_CV556330.1,dbEST_BI149923.1,dbEST_CO045006.1,dbEST_CN534943.1,REF_NM_001033375.2,GB_BC145215.1,GB_AK145000.1,GB_AK166233.1,GB_AK043911.1,GB_AK038582.1,GB_BC020314.2,GB_AK129269.1,
1213+21dbEST_CV556330.1,dbEST_CO045006.1,dbEST_CN534943.1,dbEST_CN531432.1,REF_NM_001033375.2,GB_BC145215.1,GB_AK145000.1,GB_AK166233.1,GB_AK043911.1,GB_AK038582.1,GB_BC020314.2,GB_AK129269.1,GB_BC026467.1,
1314+21dbEST_CN534943.1,dbEST_CN531432.1,dbEST_CN537767.1,dbEST_CV558405.1,REF_NM_001033375.2,GB_BC145215.1,GB_AK145000.1,GB_AK166233.1,GB_AK043911.1,GB_AK038582.1,GB_BC020314.2,GB_AK129269.1,GB_BC026467.1,
1415+25dbEST_CN531432.1,dbEST_CN537767.1,dbEST_CV558405.1,dbEST_CN532675.1,REF_NM_001033375.2,GB_BC145215.1,GB_AK145000.1,GB_AK166233.1,GB_AK043911.1,GB_AK038582.1,GB_BC020314.2,GB_AK129269.1,GB_BC026467.1,
1516+27dbEST_CN537767.1,dbEST_CV558405.1,dbEST_CN532675.1,dbEST_CN534119.1,REF_NM_001033375.2,GB_BC145215.1,GB_AK145000.1,GB_AK166233.1,GB_AK043911.1,GB_AK038582.1,GB_BC020314.2,GB_AK129269.1,GB_BC026467.1,
1617+24dbEST_CV558405.1,dbEST_CN534119.1,dbEST_CK637796.1,dbEST_CN538867.1,REF_NM_001033375.2,GB_BC145215.1,GB_AK145000.1,GB_AK166233.1,GB_AK043911.1,GB_AK038582.1,GB_BC020314.2,GB_AK129269.1,GB_BC026467.1,
1718+25dbEST_CN538867.1,dbEST_CK638759.1,dbEST_CN537380.1,dbEST_CF170749.1,REF_NM_001033375.2,GB_BC145215.1,GB_AK145000.1,GB_AK166233.1,GB_AK043911.1,GB_AK038582.1,GB_BC020314.2,GB_AK129269.1,GB_BC026467.1,
1819+27dbEST_CN538867.1,dbEST_CK638759.1,dbEST_CN537380.1,dbEST_CF170749.1,REF_NM_001033375.2,GB_BC145215.1,GB_AK145000.1,GB_AK166233.1,GB_AK043911.1,GB_AK038582.1,GB_BC020314.2,GB_AK129269.1,GB_BC026467.1,
1920+21dbEST_CK638759.1,dbEST_CN536108.1,dbEST_BG085985.2,dbEST_CN538836.1,REF_NM_001033375.2,GB_BC145215.1,GB_AK145000.1,GB_AK166233.1,GB_AK043911.1,GB_AK038582.1,GB_BC020314.2,GB_AK129269.1,GB_BC026467.1,
2021+24dbEST_BG085985.2,dbEST_CN538836.1,dbEST_BQ940601.1,dbEST_CD551784.1,REF_NM_001033375.2,GB_BC145215.1,GB_AK145000.1,GB_AK166233.1,GB_AK043911.1,GB_AK038582.1,GB_BC020314.2,GB_AK129269.1,GB_BC026467.1,
2122+26dbEST_CN538836.1,dbEST_BQ940601.1,dbEST_CD551784.1,dbEST_CK636329.1,REF_NM_001033375.2,GB_BC145215.1,GB_AK145000.1,GB_AK166233.1,GB_AK043911.1,GB_AK038582.1,GB_BC020314.2,GB_AK129269.1,GB_BC026467.1,
2223+27dbEST_BQ940601.1,dbEST_CK636329.1,dbEST_CD350612.1,dbEST_CN680170.1,REF_NM_001033375.2,GB_BC145215.1,GB_AK145000.1,GB_AK166233.1,GB_AK043911.1,GB_AK038582.1,GB_BC020314.2,GB_AK129269.1,GB_BC026467.1,
2324+29dbEST_BQ940601.1,dbEST_CK636329.1,dbEST_CK620144.1,dbEST_CN661496.1,REF_NM_001033375.2,GB_BC145215.1,GB_AK145000.1,GB_AK166233.1,GB_AK043911.1,GB_AK038582.1,GB_BC020314.2,GB_AK129269.1,GB_BC026467.1,
2425+27dbEST_CN661496.1,dbEST_BF141861.1,dbEST_BE284995.1,dbEST_CN677241.1,REF_NM_001033375.2,GB_BC145215.1,GB_AK145000.1,GB_AK166233.1,GB_AK043911.1,GB_AK038582.1,GB_BC020314.2,GB_AK129269.1,GB_BC026467.1,GB_AK161247.1,
2526+21dbEST_CK332008.1,dbEST_CF903518.1,dbEST_CF167468.1,dbEST_CN531135.1,REF_NM_001033375.2,GB_BC145215.1,GB_AK145000.1,GB_AK166233.1,GB_AK043911.1,GB_AK038582.1,GB_BC020314.2,GB_AK129269.1,GB_BC026467.1,GB_AK161247.1,
2627+27dbEST_CK332008.1,dbEST_CF903518.1,dbEST_CF167468.1,dbEST_CN531135.1,REF_NM_001033375.2,GB_BC145215.1,GB_AK145000.1,GB_AK166233.1,GB_AK043911.1,GB_AK038582.1,GB_BC020314.2,GB_AK129269.1,GB_BC026467.1,GB_AK161247.1,
2728+28dbEST_CF903518.1,dbEST_CN531135.1,dbEST_CK636681.1,dbEST_DR754383.1,REF_NM_001033375.2,GB_BC145215.1,GB_AK145000.1,GB_AK166233.1,GB_AK043911.1,GB_AK038582.1,GB_BC020314.2,GB_AK129269.1,GB_BC026467.1,GB_AK161247.1,
2829+38dbEST_CF903518.1,dbEST_CN531135.1,dbEST_CK636681.1,dbEST_BF320564.1,REF_NM_001033375.2,GB_BC145215.1,GB_AK145000.1,GB_AK166233.1,GB_AK043911.1,GB_AK038582.1,GB_BC020314.2,GB_AK129269.1,GB_BC026467.1,GB_AK161247.1,
2930+51dbEST_CN531135.1,dbEST_CK636681.1,dbEST_BB827912.1,dbEST_AA537478.1,REF_NM_001033375.2,GB_BC145215.1,GB_AK145000.1,GB_AK166233.1,GB_AK043911.1,GB_AK038582.1,GB_BC020314.2,GB_AK129269.1,GB_BC026467.1,GB_AK161247.1,
3031+44dbEST_AA537478.1,dbEST_BQ770131.1,dbEST_CN704116.1,dbEST_CN703859.1,REF_NM_001033375.2,GB_BC145215.1,GB_AK145000.1,GB_AK166233.1,GB_AK043911.1,GB_AK038582.1,GB_BC020314.2,GB_AK129269.1,GB_BC026467.1,GB_AK161247.1,GB_AK089097.1,
3132+58dbEST_CN703859.1,dbEST_CD545553.1,dbEST_BM237206.2,dbEST_BU709044.1,REF_NM_001033375.2,GB_BC145215.1,GB_AK145000.1,GB_AK166233.1,GB_AK043911.1,GB_AK038582.1,GB_BC020314.2,GB_AK129269.1,GB_BC026467.1,GB_AK161247.1,GB_AK089097.1,
3233+13dbEST_BU709044.1,dbEST_BU841859.1,dbEST_BY747526.1,dbEST_AI019789.1,REF_NM_001033375.2,GB_BC145215.1,GB_AK129269.1,GB_AK161247.1,GB_AK089097.1,