NIA Mouse Gene Index (mm92)

Exon structure for U012196

chr10 +

Exon1 128184935 - 128185054
	GAGAGGATCCAGTACTGAGCAGCAGGCCAAGAAGTTACCTCGCCGGCCGCTGAATCCCCAGGGCTGCCCGCCCCAGTTCAGTCATGGAAACCGCCAGCAC
	CCCCGAGGCCACGGGGACAG
Exon2 128185511 - 128185622
	GGATGAGGACTCCACTTCCGGCGGGGAGGGGGGCGGGACCCCAGCCCGCTCACGCCGGAAGTGGTTCGGGTTCTCAAGATGGCGACTCCCTATGTAACTG
	ACGAGACCGGCG
Exon3 128187339 - 128187393
	CTACACCTCAGGATTACTACAACCTGGACTTCATCTGTGACACATTTCCTTTCAG
Exon4 128202203 - 128202296
	GCAAGTACATTGCCTCAACACAGAGACCCGACGGGACGTGGCGAAAGCAGCGGAGGGTCAAAGAAGGATACGTGCCCCAAGAGGAGGTCCCAGT
Exon5 128202666 - 128203620
	CTATGAAAACAAGTATGTGAAGTTTTTCAAGAGTAAACCAGAACTTCCCCCAGGGCTGAGCCCTGAGGCCACCACACCGGTCACCCCATCCAGACCTGAA
	GGTGGTGAGACAGGCCTCTCCAAGACAGCCAAACGAAACCTGAAGCGGAAGGAGAAGAGGCGGCAGCAACAGGAGAAAGAAGCAGAGGCCTTGAGCAGGA
	CTCTTGATAAGGTGTCTCTGGGAGACACAGCCCAGATACCTAGTGCTCTCCAAGGCCCCCAGGCCACGCCTCTAGCTGCCTCTGATCCATCCGACTCTGC
	TGCCACCACAGAGAAAGCCAAGAAGATCAAGAACCTGAGGAAGAAGCTTCGGCAGGTGGAGGAGCTGCAGCAACGCATCCAGGCCGGGGAGGTCAGCCAG
	CCCAGCAGAGAACAGCTGGAGAAGCTGGCTCGACGGAGGGTTCTGGAGGAGGAGCTGGAGGACTTGGAGTTGGGCCTGTGAGGCTTCAGGAGTAGGGGAG
	TGGACTGCAGAACAAACCATGGGGTGCTCTGGGGTCCAGGGAGTGTGGGCCGCAGCAGTCAGGAGGGGTACCCCCATACTGACTCACCTCCACCTCCTGT
	GGCCCGACTCCGTCCTCCAGAGCCTAGGCTCTCTTTCATCCCTTCCACTTCTTCTCAGCTCCTGTTTTTGGACTTTCCCCTTCCATCCCAGTGTTCACAA
	TCTGAGTGCCGACCTGAGGTACCTCTGCTGCTGATCTGGGTGTCTTGTTGAAAAGGAAACCGGGGGGGTGGGAGTCTGTTAGCGATCTGAGGCTGAGGGT
	ATAGCAGTACCCATGTTTTGGAGTCTTAGTTCCTGTTCACAGTGTTTATGAATTACTTCCCTGACCATCCCGATTTCCCCCCACCCCACCCCCCACGCCC
	CTTAAttttttttttttttttttttAAAGAAAAGAATAAATTGAAGTAGATGACA

Links between exon parts

From
exon
To
exon
Splice
sites
SupportExamples
14+14dbEST_CN844028.1,dbEST_CK625916.1,dbEST_BY723064.1,dbEST_AV494335.1,REF_NM_030100.3,GB_AK020702.1,GB_AJ459407.1,
24+6dbEST_BI989958.1,dbEST_BU939135.1,dbEST_BQ177652.1,ENSMUST00000065210,REF_NM_001170869.1,GB_BC049647.1,
23+2dbEST_BI731887.1,REF_NR_033208.1,
34+5dbEST_BI731887.1,dbEST_CK332572.1,dbEST_BU515108.1,REF_NR_033208.1,
45+32dbEST_CN844028.1,dbEST_CK625916.1,dbEST_BY723064.1,dbEST_AV494335.1,REF_NM_030100.3,REF_NM_001170869.1,GB_AK020702.1,GB_AJ459407.1,GB_BC049647.1,