NIA Mouse Gene Index (mm92)

Exon structure for U012400

chr11 +

Exon1 28753204 - 28753324
	ctttttcctcctcctGTGGCTGCTGCTGCAGCCAGACCTCGCCAGTTCAGACCTACCAGGCTGCCCTCCCCTACGCACTCCTTCGCTGCCCGGGCAGGAA
	AGTTGCGCGGCCCCCCCGCAG
Exon2 28753809 - 28753916
	CTGAGAACGAGGGGAAAAGGGATCAGTGACTTTGAGCTGCTGATTGTGCGCCAAGAGTGTGTATGGAAATGGAGCTTTAAGAGTGGGAACTAGAGAAGTC
	ACCCTGCA
Exon3 28754465 - 28754554
	AGAATCACGATGTTGCAAACACTTTTCCTAACTATGCTGACTCTGGCGCTGGTCAAGTCACAGTACACCGAGGAAACCATCACATACACG
Exon4 28767466 - 28767514
	CAATGCACCGATGGATATGAATGGGACCCCATAAGACAGCAGTGTAAAG
Exon5 28767653 - 28768039
	ATATTGATGAATGTGACATTGTCCCAGATGCTTGCAAAGGTGGAATGAAATGTGTCAACCACTATGGAGGATATCTCTGCCTTCCTAAAACAGCCCAAAT
	TATTGTCAATAATGAGCATCCTCAGCAAGAAACACCAGCTGCAGAAGCTTCGTCAGGTGCCACCACTGGGACTGTAGCTGCCAGGAGCATGGCAACCAGT
	GGTGTGGTGCCTGGGGGTGGCTTCATGGCCAGTGCTACTGCAGTTGCTGGCCCTGAAGTTCAAACTGGCCGAAATAACTTTGTCATCCGAAGAAACCCAG
	CTGACCCTCAGCGCATCCCTTCCAACCCTTCCCACCGGATCCAGTGTGCAGCAGGCTATGAACAGAGTGAGCATAATGTGTGCCAAG
Exon6 28810610 - 28810732
	ATATTGATGAGTGCACCTCAGGGACTCACAATTGTAGAACGGACCAAGTATGCATCAATTTACGAGGTTCCTTCACATGTCAGTGTCTTCCTGGGTATCA
	GAAGCGAGGTGAACAGTGTGTGG
Exon7 28814588 - 28814707
	ATATAGATGAATGCACAGTGCCTCCATATTGCCACCAAAGATGTGTTAACACACCTGGTTCCTTCTACTGCCAGTGCAGTCCAGGGTTTCAGCTGGCAGC
	AAACAACTACACTTGTGTGG
Exon8 28815661 - 28815780
	ATATAAATGAATGTGATGCCAGCAACCAGTGTGCTCAACAATGCTACAACATTCTTGGCTCATTCATCTGTCAGTGTAATCAAGGATATGAACTAAGCAG
	TGACAGACTCAACTGTGAAG
Exon9 28816850 - 28816969
	ACATCGACGAATGCAGAACCTCAAGCTACCTATGCCAATATCAATGTGTCAATGAACCTGGGAAGTTCTCATGTATGTGCCCACAGGGTTACGAAGTGGT
	GCGCAGCAGAACCTGTCAGG
Exon10 28821403 - 28821526
	ATATAAATGAATGTGAGACCACCAATGAATGCCGAGAAGATGAGATGTGCTGGAATTACCATGGGGGCTTCCGCTGTTACCCACGAAACCCATGTCAAGA
	TCACTATGTTCTAACATCAGAAAA
Exon11 28821611 - 28821806
	CCGATGTGTTTGCCCAGTCTCAAACACTATGTGCCGGGAGCTGCCCCAGTCCATTGTCTACAAATACATGAGCATCCGATCTGACAGGTCCGTGCCTTCA
	GACATCTTCCAGATACAGGCAACAATGATTTATGCAAACACCATTAATACTTTTCGGATTAAATCTGGAAATGAAAATGGAGAGTTCTACCTACGA
Exon12 28826157 - 28826743
	CAAACAAGCCCTGTGAGTGCAATGCTGGTGCTTGTGAAGTCTCTATCAGGACCAAGAGAATACATCGTGGACCTGGAGATGCTGACAGTCAGTAGTATAG
	GAACCTTCCGCACAAGCTCTGTGTTAAGATTGACAATAATAGTGGGGCCATTTTCATTTTAGCCTTTTACTCATATAAAGCCTACTACAAGCATTTAAAT
	CAGCCAAACAATATCATTACCTTAAAACTCTATTTTATTTATAGCTATATCTAGTACATGTATATTCAAATAGCTAGACTATGGTAAGAAGTGGGCATTT
	AATCCATAAGAGTCAATGTTTATCGTTATCACTGTGTGTAAATTAGACCTTTATCCAACATTAAGAGAGCTAATCATATATTATCTAGTGAAACTTGGAT
	TCTTTCCTGCAAAATGGGACCAAGCAAGGATACTGTTCTGTGTTGTATAGAGAAATATACACCTCCACAGACCATCCCGTGAGAATTGGCCATCTTAGCA
	TGAAGATCAAGAAGGAGGGTTTTTTTAACTGCTTTGTAAGAAAATGGAAAAAAGTCAATAAAGATATATTTCTTTAGAAAATGAGAA

Links between exon parts

From
exon
To
exon
Splice
sites
SupportExamples
13+28dbEST_BY323677.1,dbEST_BB575101.2,dbEST_AW107052.1,dbEST_CX217777.1,REF_NM_146015.2,GB_AK077302.1,GB_AY251056.1,
23+5dbEST_CN688363.1,dbEST_CN688619.1,dbEST_CF726316.1,NIA_E0257B09-5,
36+2dbEST_BI736984.1,ENSMUST00000124103,
34+34dbEST_BY323677.1,dbEST_BB575101.2,dbEST_AW107052.1,dbEST_CX217777.1,REF_NM_146015.2,GB_AK077302.1,GB_AY251056.1,GB_AY185605.1,
45+36dbEST_BY323677.1,dbEST_BB575101.2,dbEST_AW107052.1,dbEST_CX217777.1,REF_NM_146015.2,GB_AK077302.1,GB_AY251056.1,GB_AY185605.1,
56+23dbEST_CX217777.1,dbEST_CJ054616.1,dbEST_CF553685.1,dbEST_AI789438.1,REF_NM_146015.2,GB_AK077302.1,GB_AY251056.1,GB_AY185605.1,GB_BC031184.1,
67+21dbEST_CF553685.1,dbEST_BI736984.1,dbEST_CB193048.1,dbEST_BQ831458.1,REF_NM_146015.2,GB_AK077302.1,GB_AY251056.1,GB_AY185605.1,GB_BC031184.1,
78+19dbEST_BI736984.1,dbEST_DV043455.1,dbEST_AW911999.1,dbEST_BG968427.1,REF_NM_146015.2,GB_AK077302.1,GB_AY251056.1,GB_AY185605.1,GB_BC031184.1,
89+17dbEST_BI736984.1,dbEST_BQ831458.1,dbEST_DV043455.1,dbEST_BG243523.1,REF_NM_146015.2,GB_AK077302.1,GB_AY251056.1,GB_AY185605.1,GB_BC031184.1,
810+3dbEST_CB575129.1,ENSMUST00000139713,ENSMUST00000093250,
910+14dbEST_BQ831458.1,dbEST_BG243523.1,dbEST_CB571711.1,dbEST_CR758435.1,REF_NM_146015.2,GB_AK077302.1,GB_AY251056.1,GB_AY185605.1,GB_BC031184.1,GB_BC023060.1,
1011+17dbEST_BQ831458.1,dbEST_CR758435.1,dbEST_DV054753.1,dbEST_CB575129.1,REF_NM_146015.2,GB_AK077302.1,GB_AY251056.1,GB_AY185605.1,GB_BC031184.1,GB_BC023060.1,
1112+21dbEST_BQ831458.1,dbEST_DV054753.1,dbEST_CB575129.1,dbEST_BI730321.1,REF_NM_146015.2,GB_AK077302.1,GB_AY251056.1,GB_AY185605.1,GB_BC031184.1,GB_BC023060.1,GB_AK162532.1,