NIA Mouse Gene Index (mm92)

Exon structure for U012850

chr11 +

Exon1a 70265403 - 70265420
	GGCGCACATTAACAGGCA
Exon1b 70265421 - 70265565
	TTTCCGGGCTGTGGCGCCACACCTCGCAAAAGACGGCCTGTGGGGCTTTCCACTGGAACGATGGCTACCTACAGTCTGGCGAACGAGCGGCTGCGCGCCC
	TGGAGGATATCGAGCGTGAAATCGGCGCCATCCTCCAGAACGCAG
Exon1c 70265566 - 70265595
	GTTCGGGAAGCGAGGGGCAGACGGCAAGGG
Exon2 70265710 - 70265840
	GAACGGCGATCCTGGAACTGTCCAAGGAAAAGACTAACGAGCGGCTCCTCGACCGGCAGGCGGCAGCCTTCACCACTTCTGTGCAGCACGTGGAGGCAGA
	GCTATCCGCTCAAATCCGCTACCTCACTCAG
Exon3a 70266604 - 70266688
	GTGGCCACAGGGCAGCCGCATGAGGGCTCCAGCTACTCTTCCAGGAAGGACTGTCAAATGGCTCTAAAGCGAGTAGACTACGCCC
Exon3b 70266689 - 70267229
	GCCTCAAGATTAGTGATGTGGCGAGAACCTGTGAGCAGATGCTGGAGAACTGAGTTCGGATGATCCAGAGTGTGCCCTGCACCAGAGACCGTAGGATGGG
	GAGCAGTGCATCATACACGTGCCCTACTGGTCAGGGCAGACGAGGACCACAAGGCAGAAAGGAGAACTGAAGAATCCAAAGCCCCAGTGTACACACATCT
	CTTCTGACTCTTCCAGCAAGACGGCCCTGTTTTCCACTATGCAAGATCAGACAGAGGTCAGAGGTCAACTCCCAACCCACTTCCTCATGTGCACCCTGCC
	CTGGAGTTTCAGAAGACTTGGCCCAATAAAAATAAATGTGTTCTTATAAGCACACACAgtggctcacacctgtaggcccggtacttgggaagtagaggtg
	ggaagattgctgtagtttgagaccaacctgggctaagtacatagagggaccctccttcaaaaGGGGAAGTTATGTTCCTCATTGGAAGAAACAAAACAGG
	AACTAAGTGTTTTAATAATAAAAGCTGTATTTTTTTATAAA

Links between exon parts

From
exon
To
exon
Splice
sites
SupportExamples
1b2+53dbEST_CA464041.1,dbEST_BE690006.1,dbEST_BE689271.1,dbEST_CX234116.1,REF_NM_025397.2,GB_AK008153.1,GB_BC025057.1,GB_AK003984.1,
1c2+3dbEST_BU757224.1,dbEST_BE554293.1,ENSMUST00000151013,
23a+60dbEST_CA464041.1,dbEST_BE690006.1,dbEST_BE689271.1,dbEST_CX234116.1,REF_NM_025397.2,GB_AK008153.1,GB_BC025057.1,GB_AK003984.1,
3a1a-2dbEST_BX521481.1,dbEST_AA987085.1,