NIA Mouse Gene Index (mm92)

Exon structure for U013004

chr11 +

Exon1 77851433 - 77851614
	ccgcggccgcagaggggcgcaggcgggcggggcTGGGGGAGGCGGGATAGGCTGGGCGCGGCCGGCGCTGCGGACCCGCCACAGCCCTCCCGGTCGCTGC
	GGACCCAAGGCCTGCTGGCCTGCCAACGGCGCCATGGGCAACTGCCACACGGTGGGCCCCAACGAGGCGCTGGTGGTCTCAG
Exon2 77853806 - 77853833
	GCCCTGTGGAAAGGCTGGCAACTACAGG
Exon3 77862980 - 77863061
	GAGGCTGTTGTGGTTCTGACTACAAACAGTATGTGTTTGGAGGCTGGGCTTGGGCCTGGTGGTGTATCTCGGACACTCAGAG
Exon4 77866702 - 77866785
	CCTGAGACTGTGCTGGCCTGGGTGGGTGGAAATACTGAGAGCACCACACCGTGCGGCAGTATATCAGGCATCAGTGCTTATCTG
Exon5 77866865 - 77866955
	ACTGTCTCTGGAGGTTATGACCATCCTGTGTCGCTGTGAGAATATTGAGACGTCGGAGGGGGTCCCGCTATTCGTAACAGGGGTTGCACAG
Exon6 77868287 - 77868377
	GATTTCCCTAGAGATTATGACGTTGCAGCCCCGCTGTGAGGACGTAGAGACGGCCGAGGGGGTAGCTTTAACTGTGACGGGTGTCGCCCAG
Exon7 77869259 - 77869382
	GTGAAGATCATGACGGAGAAGGAGCTCCTGGCTGTAGCCTGTGAACAGTTCCTGGGCAAGAACGTACAGGACATTAAGAACGTCGTGCTGCAGACCCTGG
	AGGGGCATCTACGCTCTATCCTAG
Exon8 77870764 - 77870882
	GGACTCTGACTGTAGAACAGATTTATCAGGACCGAGACCAGTTTGCCAAGCTGGTGCGGGAAGTGGCGGCCCCCGATGTTGGCCGCATGGGCATCGAGAT
	CCTCAGCTTCACCATCAAG
Retained Intron 77870883 - 77870989
	GTGAGAGATAGGAGCGGGGCTGACCCTGGGTGCGCCTGGGAGATGGGAGGGATGCCCTCTGTCCTTACGGCTGCTCCCTAGGACAAATGACCCCCTTCCT
	TCCTTAG
Exon9b 77870990 - 77871103
	GATGTTTATGACAAAGTAGACTATCTGAGCTCCCTGGGCAAGACACAGACTGCTGTGGTGCAGAGAGATGCAGACATTGGTGTGGCAGAGGCAGAACGGG
	ACGCAGGCATCCGG
Exon10 77871204 - 77871323
	GAAGCTGAATGCAAGAAGGAGATGCTAGATGTGAAGTTCATGGCAGACACCAAGATCGCTGACTCTAAGAGAGCCTTTGAGCTTCAAAAGTCAGCCTTCA
	GCGAGGAAGTCAACATCAAG
Exon11 77871402 - 77871616
	ACAGCTGAGGCCCAGTTGGCCTATGAGCTGCAAGGGGCCCGCGAGCAACAGAAGATCCGGCAGGAAGAGATTGAGATTGAGGTCGTACAGCGCAAGAAGC
	AGATCGCCGTGGAGGCGCAGGAGATCCTCCGCACCGACAAGGAGCTCATCGCCACCGTGCGCCGCCCTGCAGAGGCTGAGGCCCACCGCATCCAGCAGAT
	CGCTGAGGGCGAAAA
Exon12 77872009 - 77872192
	GGTGAAACAAGTCCTCTTGGCACAAGCAGAAGCTGAGAAGATTCGCAAAATTGGAGAGGCAGAGGCAGCAGTCATTGAGGCAATGGGCAAGGCCGAGGCT
	GAGCGGATGAAGCTTAAGGCTGAGGCCTACCAGAAGTATGGGGATGCAGCCAAGATGGCCTTGGTGCTGGAGGCCCTGCCCCAG
Exon13 77872447 - 77872596
	ATTGCTGCCAAGATCTCCGCGCCCCTGACTAAAGTCGATGAGATTGTGGTTCTCAGTGGGGACAACAGCAAGGTGACATCAGAAGTAAACCGGCTGCTAG
	CAGAACTGCCAGCCTCTGTGCACGCCCTCACCGGTGTGGACCTTTCAAAG
Exon14 77872697 - 77873936
	ATACCCCTGATCAAGAACGCCACTGGTGCACAGGTGTGAGGCTCCTGCACACTCAGCCTCCAGCAGCTGCCTGCCCTTCCAGCGCCTGTTTTAACGTCAC
	AGGGACAGCGAGAACATTTCTGACTCTGGTGCCTTATTTTGTAGGGACCAGAAGTGCTGCGTGTTCAGGCCATCTCTGGCTATCTTCCTTTCTCTCCTGT
	CTGCCTTCCTCTCTCCCATGCCCTCACATTAATGGCCACCTTCATCCAGCCTGTCTCCTCATCTGCCATATGTGCCTCTTCCTCTGGCTATCTGTTTCTC
	TCCCCTTTCTCCCCAACTTCACACACATCATCTACTTTAACTGAAGTTGAAGTTGTGTATGATAATCACTGTCTGTCTGTGAGGAGTGGCCTCGCTGCTC
	CTCAGAATCCTGGTGCCTTCAAGTTCTACATGTATCTGTCTGTCCTCCCTGGCCCTGGCAGAGCCCAGCATGGGTACAAGGGTCCTAGGTAGGACACCCA
	CTCTCCTCTCTCCTGGTCTGAATCTCCGAGTGCTGAACGCTGTTGCGGGAAGCCCACAACCCACACGCTCTTGCCCTTTGAGGCCTGAGTGGCCATGGCC
	TATTGGCCCTAGAGTAATGCCCTTGACATGCCGAGGCCCAGGCCTGCTGTCATACCTGCCCCTGTCCCCTGCACCATCACGGAGGCACAGAAGCAAGGCC
	TCCTGTCTATAGCAGCTTCCTCAGCTTACTACTGCCTTAGGAGGCCCTGCTTGTGCTCAGGGACATCCCTTCCCTTGGCTTGTCCTTGATTGGTGGGTGG
	GTCTTAGTCTGATCCCATTAAGTGTTTCTGGGGTCAATGTCTAGCTCTGTTGGGGACAAGTAAGGTTTATAGGCCTTCTTCCTGCTAGTGCATGGAGCTC
	TCCCAGGAGGCCAGGGCTGTGCCAACCCTAAGAGAATCAAGTGCTGTAGACTGGCCAAACCTCATTCCCTCAATGCCATTTTCTTGGCCAGAATAATGGG
	GACATGGGAAGCAGCTAAATATTCTATACCTTTGCACCACTGGTGGCTGAAGAGGCCAATGCCCTGGTGTCCTAGTAGGGGTACAAGGGTGTCCCGTGGG
	CCCCGTCCCCACCCCTGGCCCTGCCCAGCCTGTGTAGCTGTTCTGCATGTGAATGCTGCATGTCTGGTCCGGGATTTGGATGTTGCACTACCCCACTGCC
	TGTCCCCCTCTGGTGAAAATAAAGATCTCTTATACCCACA

Links between exon parts

From
exon
To
exon
Splice
sites
SupportExamples
13+75dbEST_CF104754.1,dbEST_BY195482.1,dbEST_BY205792.1,dbEST_BY204171.1,REF_NM_001040403.1,REF_NM_008028.2,GB_AK170557.1,GB_AK030199.1,GB_BC070423.1,GB_AK004589.1,GB_AK149530.1,GB_AK187814.1,GB_AK213895.1,
23+2ENSMUST00000136353,GB_U07890.1,
36+52dbEST_BY195482.1,dbEST_BY205792.1,dbEST_BY204171.1,dbEST_BY087093.1,REF_NM_001040403.1,GB_AK170557.1,GB_AK030199.1,GB_AK004589.1,GB_AK187814.1,GB_AK213895.1,
35+17dbEST_CF104754.1,dbEST_CJ179059.1,dbEST_CJ165212.1,dbEST_BY278781.1,REF_NM_008028.2,GB_BC070423.1,GB_U07890.1,
34+3dbEST_CJ133875.1,ENSMUST00000100786,GB_AK149530.1,
37+2dbEST_BY350546.1,dbEST_BY078761.1,
46+3dbEST_CJ133875.1,ENSMUST00000100786,GB_AK149530.1,
57+9dbEST_CJ179059.1,dbEST_CJ165212.1,dbEST_BY278781.1,dbEST_CJ146105.1,
56+10dbEST_CF104754.1,dbEST_BU703067.1,dbEST_BY036413.1,dbEST_CJ152150.1,REF_NM_008028.2,GB_BC070423.1,GB_U07890.1,
67+69dbEST_CF104754.1,dbEST_BY205792.1,dbEST_BY204171.1,dbEST_BY087093.1,REF_NM_001040403.1,REF_NM_008028.2,GB_AK170557.1,GB_AK030199.1,GB_BC070423.1,GB_AK004589.1,GB_AK149530.1,GB_AK187814.1,GB_AK213895.1,GB_U07890.1,GB_AK191802.1,
78+53dbEST_AA015132.1,dbEST_AA015558.1,dbEST_AA015551.1,dbEST_BG918153.1,REF_NM_001040403.1,REF_NM_008028.2,GB_AK170557.1,GB_AK030199.1,GB_BC070423.1,GB_AK004589.1,GB_AK149530.1,GB_AK187814.1,GB_AK213895.1,GB_U07890.1,
89b+49dbEST_BG918153.1,dbEST_BY033855.1,dbEST_BB617100.1,dbEST_BQ886227.1,REF_NM_001040403.1,REF_NM_008028.2,GB_AK170557.1,GB_AK030199.1,GB_BC070423.1,GB_AK004589.1,GB_AK149530.1,GB_U07890.1,GB_AK188583.1,
9b10+48dbEST_BG972592.1,dbEST_BQ926572.1,dbEST_BY704808.1,dbEST_BE911731.1,REF_NM_001040403.1,REF_NM_008028.2,GB_AK170557.1,GB_AK030199.1,GB_BC070423.1,GB_AK004589.1,GB_AK149530.1,GB_U07890.1,GB_AK188583.1,
1011+49dbEST_BY704808.1,dbEST_BU145646.1,dbEST_CF950152.1,dbEST_BU058916.1,REF_NM_001040403.1,REF_NM_008028.2,GB_AK170557.1,GB_AK030199.1,GB_BC070423.1,GB_AK004589.1,GB_AK149530.1,GB_U07890.1,GB_AK188583.1,GB_AK208907.1,
1112+37dbEST_BU707933.1,dbEST_BI688159.1,dbEST_BI737927.1,dbEST_BQ877524.1,REF_NM_001040403.1,REF_NM_008028.2,GB_AK170557.1,GB_AK030199.1,GB_BC070423.1,GB_AK004589.1,GB_AK149530.1,GB_U07890.1,
1213+38dbEST_CX205958.1,dbEST_BM951558.1,dbEST_BM951814.1,dbEST_BI147937.1,REF_NM_001040403.1,REF_NM_008028.2,GB_AK170557.1,GB_AK030199.1,GB_BC070423.1,GB_AK004589.1,GB_AK149530.1,GB_U07890.1,
1314+39dbEST_BI147937.1,dbEST_CF618129.1,dbEST_CA976764.1,dbEST_BI905654.1,REF_NM_001040403.1,REF_NM_008028.2,GB_AK170557.1,GB_AK030199.1,GB_BC070423.1,GB_AK004589.1,GB_AK149530.1,GB_U07890.1,