NIA Mouse Gene Index (mm92)

Exon structure for U013484

chr11 +

Exon1 108204668 - 108204838
	TTCTCGGAGGAGTCCTGGCCCTGAGAGTAAGGACGCGCCGGGGCTCAGAGACGTCCCCGAGCTTAAGTCCCGGGGACAAGCAGACCTGAGCCCCGGGGCA
	AAGGTGGCTCTTGGGTCCCCAGGGCTGCCGCGCGCACCTACCAGATGAAGTCGGTGCAGTGGCTGCAGAAG
Exon2a 108256611 - 108256615
	TTCAG
Exon2b 108256616 - 108256721
	CAGAAGACACCACTTTGGTGAAGCTGGTGGGACGCATCCGCAATGGTTTCCCCGGTGCTCGCCTTGTTCTCCGCCTTCCTCTGCCATGTTGCTATTGCAG
	GACGGA
Exon3 108257130 - 108257158
	TCTGTCCGAAGCCGGATGACCTACCATTT
Retained Intron 108257159 - 108257225
	GCTACGGTTGTCCCCTTAAAGACATCCTACGACCCTGGGGAGCAGATTGTCTACTCCTGCAAGCCAG
Exon4b 108257226 - 108257306
	GCTACGTGTCCAGGGGAGGGATGAGACGGTTTACCTGTCCTCTCACAGGAATGTGGCCCATCAACACCCTGAGATGTGTCC
Exon5 108258613 - 108258709
	CCAGAGTATGTCCTTTCGCTGGAATCTTAGAAAATGGAATTGTACGCTACACGAGTTTTGAATATCCCAAGAACATCAGTTTTGCTTGTAACCCTGG
Exon6 108260352 - 108260377
	GAGAATCCCTTCAGTtttctttcttt
Exon7 108260489 - 108260618
	ctttctttctttctttctttctttctttctttctgttattagacgcgttctcacgaccggccaggaagaacaccacagaccagaatcttctgcggcaaag
	ctttattcttacatcttcaggagccagagt
Exon8 108266125 - 108266201
	GTTTTTTCTGAATGGGACCAGCTCATCTAAGTGCACGGAGGAAGGAAAATGGAGCCCAGATATTCCTGCTTGTGCTC
Exon9 108268605 - 108268793
	GCATCACCTGCCCGCCACCACCAGTTCCAAAGTTTGCACTCCTTAAGGATTATAGGCCTTCAGCTGGGAACAACTCTTTGTATCAGGACACAGTGGTCTT
	TAAATGCTTGCCACACTTTGCCATGATCGGAAATGACACAGTCATGTGCACAGAACAAGGAAACTGGACCCGATTGCCAGAATGCCTGG
Exon10 108270445 - 108270624
	AAGTAAAATGTCCCTTCCCTCCGAGGCCAGAAAATGGGTATGTGAATTATCCTGCAAAGCCGGTGCTTCTATATAAGGATAAAGCCACATTTGGTTGCCA
	TGAGACATACAAGCTGGACGGCCCAGAAGAAGCGGAATGTACCAAGACGGGAACTTGGTCCTTCTTGCCGACCTGTAGAG
Exon11 108273309 - 108273506
	AGTCTTGCAAACTCCCCGTTAAGAAAGCCACCGTGCTGTACCAAGGGATGAGGGTGAAGATCCAGGAACAGTTTAAGAATGGGATGATGCATGGCGACAA
	AATTCACTTCTACTGCAAAAACAAAGAGAAGAAGTGCAGCTACACTGTGGAGGCTCATTGCAGAGATGGCACTATCGAGATTCCCTCGTGCTTCAAGG
Exon12 108275554 - 108275721
	AGCACAGTTCTCTGGCTTTCTGGAAAACGGATGCATCAGAACTGACACCGTGCTGAAGTCGTTTCCAGAATCAAAATTGAATGTCGTATTTGTATTTCTG
	CTTGTCTTAGGAATCCATCTGAAATAGCAGAATAAAGTTACTGGATTGCCTCAGTTATTACAGTGTGA

Links between exon parts

From
exon
To
exon
Splice
sites
SupportExamples
12b+2dbEST_BY335384.1,ENSMUST00000133383,
12a-0
2b3+157dbEST_BY335384.1,dbEST_BY082630.1,dbEST_BY091797.1,dbEST_CA464795.1,REF_NM_013475.4,GB_Y11356.1,GB_BC011037.1,GB_BC019811.1,GB_AK010926.1,GB_S70439.1,GB_BC053338.1,GB_D10056.1,
34b+1dbEST_AI116628.1,
4b5+158dbEST_CA464795.1,dbEST_AI196073.1,dbEST_AI530154.1,dbEST_CA458668.1,REF_NM_013475.4,GB_Y11356.1,GB_BC011037.1,GB_BC019811.1,GB_AK010926.1,GB_S70439.1,GB_BC053338.1,GB_D10056.1,
58+126dbEST_CA464795.1,dbEST_AI530154.1,dbEST_AI048312.1,dbEST_CA458991.1,REF_NM_013475.4,GB_Y11356.1,GB_BC011037.1,GB_BC019811.1,GB_AK010926.1,GB_S70439.1,GB_BC053338.1,GB_D10056.1,
56+1dbEST_AI116344.1,
67-1dbEST_AI116344.1,
78+1dbEST_AI116344.1,
89+139dbEST_AI530154.1,dbEST_AI117113.1,dbEST_CA458991.1,dbEST_BF537710.1,REF_NM_013475.4,GB_Y11356.1,GB_BC011037.1,GB_BC019811.1,GB_AK010926.1,GB_S70439.1,GB_BC053338.1,GB_D10056.1,
910+82dbEST_AI117113.1,dbEST_BI220689.1,dbEST_CA494168.1,dbEST_AI047862.1,REF_NM_013475.4,GB_Y11356.1,GB_BC019811.1,GB_AK010926.1,GB_S70439.1,GB_BC053338.1,GB_D10056.1,
1011+105dbEST_AI528113.1,dbEST_AI529595.1,dbEST_AI226557.1,dbEST_AI530231.1,REF_NM_013475.4,GB_Y11356.1,GB_BC011037.1,GB_BC019811.1,GB_AK010926.1,GB_S70439.1,GB_BC053338.1,GB_D10056.1,
1112+116dbEST_AI530231.1,dbEST_AI114888.1,dbEST_AI256010.1,dbEST_AI530282.1,REF_NM_013475.4,GB_Y11356.1,GB_BC011037.1,GB_BC019811.1,GB_AK010926.1,GB_S70439.1,GB_BC053338.1,GB_D10056.1,