NIA Mouse Gene Index (mm92)

Exon structure for U014680

chr13 +

Exon1 27404490 - 27404561
	AGCGCAGCTGCATTCCGTGGCCCACAGACGTGGTCATTTCCCAGATgctgtctttgagtcaaccttgcttct
Exon2 27405815 - 27406105
	AGTGGTGAATGATTTTAAAAAGACATGTCAGAAGGCCATTCTAGCTATTGGCCCTGCAGGTTCATGTTCTCTCATAGACTTAGCTGTGTGTGGGCAGCAG
	CTGTGGTTCTCTGGATGAAGACTCAGGGCCTCAGCTGCATGGATGTATTCAAGTCCAAAGATTTCTCCATGTCAGAGTAGGATTGAGACAATATGTCTCT
	GAATGGAGAAGCACAGAGGAGATGATGTCCATAAATTAGTGAAGGAAGATGAGTGGTGAAGAGTTGCCTGAGAAGGCAAAGAAAAAAGAAG
Exon3 27407148 - 27407326
	CAGGGACTCTCCTGATGCTGTTGGCATCAAACTTCCTTCTGTGGAAGAATGTGGCCCCTGTGCCCATGTATGCCAGTTTGGATGAATATGGTGAGATGTC
	CATATATGACCTGCTTGATCACGTCACCATACTATCTCATAATGTCAGTGAGCTCACTGCAGAAATGCACAGGATATTT
Exon4 27408124 - 27408237
	ATGGAGGATGTGCGATATAAACCAGGCAGGTGGTTCTCTGACAGATACCTTACTGCCTGCCACACATCTACATTGACTATTTCAGTGTCTAAGGAGGGAG
	CCCGACAGATGCCG
Exon5 27409842 - 27410021
	GGTGTATTCCTTGTGAAAGAGATGATCAGTATGTTGACAGCTTGGAGATATCCTCTGTATCACATAATAACTGAACTGAGTTATATGGAGCAAGCTCCAG
	ATGAGATCATATCAAGAGCCAGAAATATTGAAGAAAAAATCATAGTACTTATAGAAGCTCTTAGAGGGATACTCAGCAAG
Exon6 27410793 - 27411121
	ATTCAGCCTGGACCCCCAGAAAATGAGAGATATCCCGTGTGGAATGAACTGGCATCCTTGCAGTCACCTGATGAAGACCTTCGCCATCTTACATTATTTA
	ACTTATTCCAGTGCTTGGTCAAGGATTCACGTAAGATTGACTCTAGTATCAGGCTTTTGAAGTGCAAACTTCTCTATAACAGAGATTGTTAATCTCACAA
	CCATCCAATTTACTTTTAGAGTGATCTTTTTAATCTATCTTATTTTAACCAATTTATAATTTGTAACTTTGAATGAATGTTATTGTGTGAAGAATCCTTC
	ATTAGAAATAAAAACAGACTCTTTAAACA

Links between exon parts

From
exon
To
exon
Splice
sites
SupportExamples
13+7dbEST_BB611799.1,dbEST_AA110117.1,ENSMUST00000091680,REF_NM_011166.2,GB_AF015563.1,GB_AF011384.1,GB_BC140214.1,
23+1ENSMUST00000091679,
34+10dbEST_BB611799.1,dbEST_AA110117.1,dbEST_AI226131.1,dbEST_BX519061.1,REF_NM_011166.2,GB_AF015563.1,GB_AF011384.1,GB_BC140214.1,
45+9dbEST_BB611799.1,dbEST_AI226131.1,dbEST_BX519061.1,ENSMUST00000091680,REF_NM_011166.2,GB_AF015563.1,GB_AF011384.1,GB_BC140214.1,
56+8dbEST_BB611799.1,dbEST_BX519061.1,ENSMUST00000091680,ENSMUST00000091679,REF_NM_011166.2,GB_AF015563.1,GB_AF011384.1,GB_BC140214.1,