NIA Mouse Gene Index (mm92)

Exon structure for U016386

chr15 +

Exon1 76725474 - 76725541
	TCTGGGACTCATGCTGTCATGTCTTTCAAAAGGTGTTTTCTggttgctgatgtagcttggttgaatgc
Exon2 76730340 - 76730422
	GTGTCTAAGTGGCACTTCCTGAGACTCGGCCAAGTTTCAGCTGCTGCCAGCCACAGCCAGCTCCTGCGGATAGCTTCCTCCAG
Exon3a 76730782 - 76730864
	GCTACTGTGGTTAGTACCTTCTCTCCGGCCTGGTCAAGAAAGGGAAAGGAAGGATGTCTGCGTTGGGGGCTGCGGCTCCATAC
Exon3b 76730865 - 76731137
	TTACACCATCCAACTGACAGTCACAGCGGCCGGGTCAGTTTCCTGGGTTCCCAGCCCTCTGCAGAAGTGACGGCAGTGGCCCAGCTCTTGAAGGACTTAG
	ACAGGAGCACCTTCAGAAAGTTGTTGAAACTCGTAGTCGGGGCCCTCCATGGGAAAGACTGCAGAGAGGCCGTGCAGCACCTTGGTGCCAGCGCCAACCT
	GTCAGAGGAGCGTCTGGCCGTCCTGCTGGCGGGCACACACACCCTGCTCCAGCAGGCTCTCCGGCTGCCCCCT
Exon3c 76731138 - 76731735
	GCCAGTCTGAAACCAGATGCCTTCCAGGACGAACTCCAGGAACTTGGCATTCCCCAAGATATGATTGGAGATCTGGCCAGTTTGGCATTTGGGAGTCAAC
	GCCCTCTTCTCGACTCTGTAGCCCAGCAGCAGGGATCCTCGCTGCCTCGTGTGTCGAATTTCCGGTGGCGGGTGGATGTGGCCATCTCAACCAGTGCTCA
	GTCCCGCTCCCTGCAACCGAGTGTTCTCATGCAGCTGAAGCTCACAGATGGATCGGCACACCGCTTCGAGGTGCCCATAGCCAAATTCCAGGAGCTGCGC
	TACAGCGTGGCGTTGGTCCTTAAGGAGATGGCAGAGCTGGAGAGAAAGTGTGAGCGCAAACTGCAGGACTGAACCCTGGTACTGTGGGGTGCTGAAGCTG
	GTACCAGAACCCAGCCGCACTGGTGATGAGGATGTAAGAACATATTTTAAGTGAAAAGACAGCTGGGACTTTTGGGTTTTGTTTTACAAGTAAACAGCTG
	GGCTGAGGCTGGAGAATGTGAAATGTAAGGCCGGCCTGGCTGGGTTTTACGTAGTGAGGCTCAGTTTCGAATTAAAGAGGTAAAGCAACTATTAAAAA

Links between exon parts

From
exon
To
exon
Splice
sites
SupportExamples
13b+1dbEST_BY000497.1,
23a+26dbEST_AA065442.1,dbEST_AA450933.1,dbEST_AA032667.1,dbEST_AA034568.1,REF_NM_025536.2,GB_AK010045.1,GB_BC025891.1,