NIA Mouse Gene Index (mm92)

Exon structure for U016389

chr15 +

Exon1 76778936 - 76778974
	GGATTTACCAGCTTCCGGCGGCCGCTCCGACTAATGGCG
Exon2 76779059 - 76779349
	GAGCCAGGGCGTCCTGCTCGGGAGGCACCAGCAGCCTCAAGTCGGAAAACTCATCGCGCTCCGCGCAGACCCCGGCCCTCTCGCTCAGCTTCCGGTGCCT
	CGGAACCTCCTCTCCGCAGTTCAGTGCAACCTGCATGCGACTCCGCCGCCGGAACCCATCCCGTAGGCAACACAGTAGCGATGAAGCAAAAGAAAAAGAA
	AACCCCCAACAGGGTCTCTGGGACAAATGGAAGCGAAAAGCCCTCGGAGAAACCTGCCCCGGACGAAGCTCCTCCTAGCGCTGAGGCCCAG
Exon3 76779498 - 76779582
	GCGGAACAGCTGGCGCGGGAGCTGGCCTGGTGTGTGGAACAGCTGGAGCTGGGTCTCAAGACGCAGAGACCTACCCCGAAGCAGA
Exon4 76779974 - 76780120
	AAGAGCAGGCTGTTGGGGCAATCCGAACGCTGCGCAGTGAAAAAACCCCCTTGCCCCGGAAGAGACAGCTGATGCGCTCCTTGTTTGGGGACTACAGGGC
	TCAGATGGATGCAGAGTGGCGGGAGGCCCTACGGGCTCTAAAGGCTG
Exon5 76780679 - 76781409
	CCACCCATTCGGCCCAGGTACAGCTCGTCAGTGAGGCCACCAGAAAGAAGAGCGGAAGGGTCTGCAGGCCTCGTCCTGCAGAAAGAGCCAAAACCACTCC
	GGACTTGACCAGCGAAGAGTTTCGGTTCAATTTCTTTTAGGGTCTCCTACATGCTGGACCGCTCATCCCCCTCCAGGGTGGGGTGGGGATGTGTCCTGAT
	TGCAGGGCCTTCCCAGGAATTCTCTCAGCAGAAGTGGGGTTGGTTTGTCCTTCATTGCAGCATGGACCTGAAGCGGCTGGCCTATGTGAGGCTGCTATGT
	GGATGTGGAAACCTTTGAAGGAAATGTTCTTCATGTCAGAAGAGAGGTGCAGAGTAGCTGCTGATGATAAGGAACTGTGGGGAAGTTGTGGACACAGTGG
	GCTCACTTTTGAAAAGATGCTCAGGCCATTTTTCTAGTGCTTTGTATATTGTTATATCGCCTTAATAAATCTTTTCTAAGGAAATAGGATGGTGTGAGAG
	AGAGAGTTCCGAATGTGTTAGAGGAGGCAAGACTGCTTGGTCCAGCTCTGATCCAGGACTTAGTCCTTTGCTGCTGTTGTTGCTGTTTCCCTCAGCAGGT
	TGTCGTCTTCTGGAGCCAGTGTGGTCTCCATCAAGCCACGTTTTGTTTTTAGGAGCTAAGAAGCTACTCACTGTCTTAGCCTGAGCTGAGTCTTAGCAGA
	CTGCATCAAAACAAAACAAACACAACACAAC

Links between exon parts

From
exon
To
exon
Splice
sites
SupportExamples
12+11dbEST_BE987597.1,dbEST_BE987430.1,dbEST_BE987375.1,dbEST_BE981332.1,GB_AK153059.1,
23+62dbEST_AA266195.1,dbEST_AA000120.1,dbEST_AA444648.1,dbEST_AA516589.1,REF_NM_054099.2,GB_AK153059.1,GB_AK160695.1,GB_BC038324.1,GB_AK004154.1,GB_AK141496.1,GB_BC091734.1,
34+58dbEST_AA266195.1,dbEST_AA000120.1,dbEST_AA444648.1,dbEST_AA516589.1,REF_NM_054099.2,GB_AK153059.1,GB_AK160695.1,GB_BC038324.1,GB_AK004154.1,GB_BC091734.1,
45+44dbEST_AA516589.1,dbEST_AA896094.1,dbEST_AA717458.1,dbEST_AV462610.1,REF_NM_054099.2,GB_AK153059.1,GB_AK160695.1,GB_BC038324.1,GB_AK004154.1,GB_AK141496.1,GB_BC091734.1,