NIA Mouse Gene Index (mm92)

Exon structure for U016738

chr15 +

Exon1 103070376 - 103070548
	AGGCGCCTAGGTTCACAACCCTCTCCCGCCCGCCATTTCACGTGTTCCAGGCAGCAGGCGGAACATCGTAGTGCGCCGGCGTGAACTCGCCATTTTTATT
	ACACATGCGCCTTATAGGGAGTGGCTGGGAAAAGTCGCGGTGAGCTACTTTGTAGCGTGCGGTCCTTTGACGA
Exon2 103070910 - 103070959
	GAAGCATCGCTGAAGGCTCTCGTAACTCTACCGTCATGTCTAAGTCCGAG
Exon3a 103071511 - 103071581
	TCTCCCAAGGAGCCAGAACAGCTGCGGAAGCTCTTCATCGGAGGGCTGAGCTTCGAAACAACCGACGAGAG
Exon3b 103071582 - 103071627
	TCTGAGGAGCCATTTTGAGCAATGGGGAACACTAACAGACTGTGTG
Exon4 103071877 - 103072023
	GTAATGAGAGATCCAAACACCAAGAGATCCAGGGGCTTTGGGTTTGTCACATATGCCACTGTGGAAGAAGTGGATGCTGCCATGAATGCAAGACCACACA
	AGGTGGATGGAAGAGTTGTGGAACCTAAGAGAGCTGTCTCAAGAGAA
Exon5 103072334 - 103072544
	GATTCTCAGCGACCAGGTGCCCACTTAACTGTGAAAAAGATCTTTGTTGGTGGTATTAAAGAAGACACTGAAGAACATCACCTACGAGATTATTTTGAGC
	AGTATGGGAAGATTGAAGTGATAGAAATTATGACTGACAGAGGCAGTGGGAAAAAGAGGGGCTTTGCTTTTGTTACCTTTGATGACCATGACTCTGTGGA
	TAAGATTGTTA
Exon6 103072637 - 103072729
	TTCAGAAATACCATACTGTGAATGGCCACAACTGTGAAGTAAGAAAGGCTCTGTCGAAGCAAGAGATGGCTAGTGCTTCATCCAGTCAGAGAG
Exon7 103072811 - 103072903
	GTCGCAGTGGTTCTGGAAACTTTGGTGGTGGTCGTGGAGGCGGTTTTGGTGGCAATGACAATTTTGGTCGAGGAGGGAACTTCAGTGGTCGTG
Exon8 103073075 - 103073149
	gtggctttggtggcagccgtggtggtggtggatatggtggcagtggggatggctataatggatttggcaatgatg
Exon9 103073353 - 103073511
	GTGGTTATGGAGGAGGCAGCCCTGGTTACTCTGGAGGAAGCAGAGGCTATGGAAGTGGTGGACAGGGTTATGGAAACCAGGGCAGTGGCTATGGCGGGAG
	TGGCAGCTATGACAGCTATAACAACGGAGGAGGCGGAGGCGGCTTTGGCGGTGGTAGTG
Exon10 103074056 - 103074211
	GAAGCAATTTTGGAGGTGGTGGAAGCTACAATGATTTTGGCAATTACAACAATCAGTCTTCCAATTTTGGGCCGATGAAGGGAGGAAACTTTGGAGGCAG
	GAGCTCTGGCCCTTATGGTGGTGGAGGCCAGTACTTTGCTAAACCACGGAACCAAG
Exon11 103074390 - 103074459
	GTGGCTATGGCGGTTCCAGCAGCAGCAGTAGCTATGGCAGTGGCAGGAGGTTCTAATTACATACAGCCAG
Exon12a 103074687 - 103074717
	GAAACAAAGCTTAGCAGGAGAGGAGAGCCAG
Exon12b 103074718 - 103075020
	AGAAGTGACAGGGAAGCTACAGGTTACAACAGATTTGTGAACTCAGCCAAGCACAGTGGTGGCAGGGCCTAGCTGCTACAAAGAAGACATGTTTTAGACA
	ATACTCATGTGTGTGGGCAAAAACTCCAGGACTGTATTTGTGACTAATTGTATAACAGGTTATTTTAGTTTCTGTTCTGTGGAAAGTGTAAAGCATTCCA
	ACAAAAGGTTTTACTGTAGACCTTTTTCACCCATGCTGTTGATTGCTAAATGTAATAGTCTGATCATGACGCTGAATAAATGTGTCtttttttttttttt
	ttt
Exon12c 103075021 - 103076397
	aaatGTGCTGTGTAAAGTTAGTCTATTCTGAAGCCATCTTGGTAAACTTCCCCAACAGTGTGAAGTTAGAATTCCTTCAGGGTGGTGCCAAGTTCCATTT
	GGAATTTATTTATGGTTGCTTGGGTGGAGAAGCCATTGTCTTCAAAAACCTTGATGTCGTTAAACTGCCAGTTACTATTGTAACTTTTAATGAGTTTCAC
	CATTGAAAGGGTCATCCAAGCAAGGTCACAATTTGGTTATAAAATGGTTGTTGGCACACCCTATGCAATATCAAAATTGAATAACGGTATCAGATAAAAT
	AACAGATGGGAATGAAGCTTATGTATCCATTATCATGTGTACTCAATAAACGATTTAATTCTCTTGAATGGAATGACAACTGTATGGATTTGGGACTGGC
	AGAGATTTGGACTTTCCCTACCCAATGCCCCTGGTAAATGCTCATTGTTTGTTACCACAGTGCAAGTTCAAAGCTCTGCCAGCAGAGAGGCCAACTGCTG
	GTTAATGCCACCTATAAGTCCAGAGATTAGCATTGTTGGGGCATCTTAACTGATAATTAGTAAGAACTCTTAATTGCCCTAACCCATAGGCTGTAGTGAA
	GGAAAACTGCAGTTTAACTGGGTTGTGGGTGGGTGTTGCTTTTGGGGTTTTGTCTTTTTTTTTTTTAATTTTAGATGATTCTAGTTCATTGGAATTTTAA
	ATTACAAATACAGTTAACCACGATTATGTGTAATTCTGTATTAACGGCAGTTTTCCTTCACACTACTGTCCTCAAGTGTTAATTGTATAGAAAATGAGTT
	CAAAACAATTACTCTCCAATTGTTACTTGTGCATAGGTTCTTAAAGAGTTTCCCATTTGATGCCCCTTTTAAGTGCCATTGTACCGGGTAGCATAGATGA
	ATGTTTACCACAGGACTATGTATTCCAACTCATGGGTGTATATATATTGCTTGGAAGTTTTGGTGGAGGGGGGTGGGAGGAGTGGGAGGTGAGGGTGGGG
	GAAGCATGGATGGTAGTTCCATGATACTGGCTGAGTTTGCAATAGCAGGTGGAACCTTAACTATTAAGGGAGTTTGCAGATACCTCAGGAATCGGGACAA
	TGCCTTTAAAGATCCAGGAGATGTTCAGCTACTAGGAACTGCTAGCAAGTATAGCGCGAATGGCTTCCAGCTCAGAATCTCTACAGCTGAGAGTAGACAC
	TTGTGGTATGTGGAGTACAGATAAGCCAGGGGCAGGCCACGGCACCTCCATGAAAGCTAGGAGGGAGTGAAGTTTGAGTGACCATCGCAAGGAAGGAGGC
	AGACGAGAGTAAGGCACACCTGACTCTTAGGACTAGCAGGCAGAGCCAGAAGGAAAGGTTTATTGCTATGCTGCTAG
Exon13 103076777 - 103076852
	GAAGGAATCTGCTATGAGGCTTAACTGCTGTCATAAAATTTGTTTAAAAAATTCTGCAGAAGTTGCTGGCCAAAAG
Exon14 103076976 - 103077127
	GAACATCCTTAAGACAGCAGCCTTTATTCTGGGCCACTGTACTCCACTCACTGCCATGCAGTTGGGTTTTAGCTGTACTGCTAAAAAATCATTCAATTTT
	GTGAATGGCTTACTTTGGtttttttttttaaataaactttttaattaaCTCC

Links between exon parts

From
exon
To
exon
Splice
sites
SupportExamples
12+20dbEST_AV445240.1,dbEST_BY098890.1,dbEST_BY170551.1,dbEST_BY249874.1,
23b+1dbEST_CJ088488.1,
23a+1015dbEST_AA123155.1,dbEST_AA445055.1,dbEST_AA517209.1,dbEST_AA684407.1,REF_NM_001039129.3,REF_NM_010447.4,GB_AK131999.1,GB_AK146630.1,GB_AK136113.1,GB_AK168531.1,GB_AK135391.1,GB_AK152684.1,GB_AK161730.1,GB_AK166901.1,GB_AK167161.1,GB_AK167810.1,GB_AK167811.1,GB_AK168733.1,GB_AK169216.1,GB_AK168420.1,GB_AK088308.1,GB_AK166989.1,GB_AK146126.1,GB_AK167820.1,GB_AK167913.1,GB_AK007802.1,GB_M99167.1,GB_BC052723.1,GB_BC080675.1,GB_BC092395.1,GB_BC089340.1,GB_BC083136.1,GB_D86728.1,GB_D86729.1,
3b4+1138dbEST_AA123155.1,dbEST_AA445055.1,dbEST_AA230845.1,dbEST_AA517209.1,REF_NM_001039129.3,REF_NM_010447.4,GB_AK131999.1,GB_AK146630.1,GB_AK136113.1,GB_AK168531.1,GB_AK135391.1,GB_AK152684.1,GB_AK161730.1,GB_AK166901.1,GB_AK167161.1,GB_AK167810.1,GB_AK167811.1,GB_AK168733.1,GB_AK169216.1,GB_AK168420.1,GB_AK088308.1,GB_AK166989.1,GB_AK146126.1,GB_AK167820.1,GB_AK167913.1,GB_AK007802.1,GB_M99167.1,GB_BC052723.1,GB_BC080675.1,GB_BC092395.1,GB_BC089340.1,GB_BC083136.1,GB_D86728.1,GB_D86729.1,
45+1014dbEST_AA123155.1,dbEST_AA445055.1,dbEST_AA230845.1,dbEST_AA517209.1,REF_NM_001039129.3,REF_NM_010447.4,GB_AK131999.1,GB_AK146630.1,GB_AK136113.1,GB_AK168531.1,GB_AK135391.1,GB_AK152684.1,GB_AK161730.1,GB_AK166901.1,GB_AK167161.1,GB_AK167810.1,GB_AK167811.1,GB_AK168733.1,GB_AK169216.1,GB_AK168420.1,GB_AK088308.1,GB_AK166989.1,GB_AK146126.1,GB_AK167820.1,GB_AK167913.1,GB_AK007802.1,GB_M99167.1,GB_BC052723.1,GB_BC080675.1,GB_BC092395.1,GB_BC089340.1,GB_BC083136.1,GB_D86728.1,GB_D86729.1,GB_AK187715.1,
56+403dbEST_AA123155.1,dbEST_AA155511.1,dbEST_AA414591.1,dbEST_AA645124.1,REF_NM_001039129.3,REF_NM_010447.4,GB_AK131999.1,GB_AK146630.1,GB_AK136113.1,GB_AK168531.1,GB_AK135391.1,GB_AK152684.1,GB_AK161730.1,GB_AK166901.1,GB_AK167161.1,GB_AK167810.1,GB_AK167811.1,GB_AK168733.1,GB_AK169216.1,GB_AK168420.1,GB_AK088308.1,GB_AK166989.1,GB_AK146126.1,GB_AK167820.1,GB_AK167913.1,GB_AK007802.1,GB_M99167.1,GB_BC052723.1,GB_BC080675.1,GB_BC092395.1,GB_BC089340.1,GB_BC083136.1,GB_D86728.1,GB_D86729.1,GB_AK187715.1,
67+319dbEST_AA155511.1,dbEST_AA119559.1,dbEST_AA414591.1,dbEST_AA645124.1,REF_NM_001039129.3,REF_NM_010447.4,GB_AK131999.1,GB_AK146630.1,GB_AK136113.1,GB_AK168531.1,GB_AK135391.1,GB_AK152684.1,GB_AK161730.1,GB_AK166901.1,GB_AK167161.1,GB_AK167810.1,GB_AK167811.1,GB_AK168733.1,GB_AK169216.1,GB_AK168420.1,GB_AK088308.1,GB_AK166989.1,GB_AK146126.1,GB_AK167820.1,GB_AK167913.1,GB_AK007802.1,GB_M99167.1,GB_BC052723.1,GB_BC080675.1,GB_BC092395.1,GB_BC089340.1,GB_BC083136.1,GB_D86728.1,GB_D86729.1,GB_AK187715.1,
78+247dbEST_AA571223.1,dbEST_AA896734.1,dbEST_AA522349.1,dbEST_AA501002.1,REF_NM_001039129.3,REF_NM_010447.4,GB_AK131999.1,GB_AK146630.1,GB_AK136113.1,GB_AK168531.1,GB_AK135391.1,GB_AK152684.1,GB_AK161730.1,GB_AK166901.1,GB_AK167161.1,GB_AK167810.1,GB_AK167811.1,GB_AK168733.1,GB_AK169216.1,GB_AK168420.1,GB_AK088308.1,GB_AK166989.1,GB_AK146126.1,GB_AK167820.1,GB_AK167913.1,GB_AK007802.1,GB_M99167.1,GB_BC052723.1,GB_BC080675.1,GB_BC092395.1,GB_BC089340.1,GB_BC083136.1,GB_D86728.1,GB_D86729.1,
811+2dbEST_CB183065.2,GB_D86728.1,
89+40dbEST_AA522349.1,dbEST_AA210421.1,dbEST_AV468833.1,dbEST_AV469686.1,REF_NM_001039129.3,GB_AK146630.1,GB_AK168733.1,GB_AK166989.1,GB_AK146126.1,GB_BC052723.1,GB_BC092395.1,GB_BC089340.1,
810+145dbEST_AA571223.1,dbEST_AA501002.1,dbEST_AA538139.1,dbEST_AA140307.1,REF_NM_010447.4,GB_AK131999.1,GB_AK136113.1,GB_AK168531.1,GB_AK135391.1,GB_AK152684.1,GB_AK161730.1,GB_AK166901.1,GB_AK167161.1,GB_AK167810.1,GB_AK167811.1,GB_AK169216.1,GB_AK168420.1,GB_AK088308.1,GB_AK167820.1,GB_AK167913.1,GB_AK007802.1,GB_M99167.1,GB_BC080675.1,GB_BC083136.1,GB_D86729.1,
910+31dbEST_AA210421.1,dbEST_AA467556.1,dbEST_AV573101.1,dbEST_AV459260.1,REF_NM_001039129.3,GB_AK146630.1,GB_AK168733.1,GB_AK166989.1,GB_AK146126.1,GB_BC052723.1,GB_BC092395.1,GB_BC089340.1,
911+1dbEST_BF466706.1,
1011+231dbEST_AA675216.1,dbEST_AA617596.1,dbEST_AA895040.1,dbEST_AA675440.1,REF_NM_001039129.3,REF_NM_010447.4,GB_AK131999.1,GB_AK146630.1,GB_AK136113.1,GB_AK168531.1,GB_AK135391.1,GB_AK152684.1,GB_AK161730.1,GB_AK166901.1,GB_AK167161.1,GB_AK167810.1,GB_AK167811.1,GB_AK168733.1,GB_AK169216.1,GB_AK168420.1,GB_AK088308.1,GB_AK166989.1,GB_AK146126.1,GB_AK167820.1,GB_AK167913.1,GB_AK007802.1,GB_M99167.1,GB_BC052723.1,GB_BC080675.1,GB_BC092395.1,GB_BC089340.1,GB_BC083136.1,GB_D86729.1,
1112a+200dbEST_AA140307.1,dbEST_AA617596.1,dbEST_AA387040.1,dbEST_AA675440.1,REF_NM_001039129.3,REF_NM_010447.4,GB_AK131999.1,GB_AK146630.1,GB_AK168531.1,GB_AK135391.1,GB_AK152684.1,GB_AK161730.1,GB_AK166901.1,GB_AK167161.1,GB_AK167810.1,GB_AK167811.1,GB_AK168733.1,GB_AK169216.1,GB_AK168420.1,GB_AK088308.1,GB_AK166989.1,GB_AK146126.1,GB_AK167820.1,GB_AK167913.1,GB_M99167.1,GB_BC052723.1,GB_BC080675.1,GB_BC092395.1,GB_BC089340.1,GB_BC083136.1,GB_D86728.1,GB_D86729.1,
1112b+2dbEST_AW557737.2,NIA_L0285F01-3,
1113+47dbEST_AA672806.1,dbEST_AA815843.1,dbEST_AA185400.1,dbEST_AI314178.1,GB_AK136113.1,GB_AK007802.1,
12c13+2dbEST_CO041604.1,GB_BC052723.1,
1314+85dbEST_AA672806.1,dbEST_AA815843.1,dbEST_AA185400.1,dbEST_AA793193.1,GB_AK136113.1,GB_AK007802.1,GB_BC052723.1,