NIA Mouse Gene Index (mm92)

Exon structure for U016859

chr16 +

Exon1 16983475 - 16983832
	GACGCGAACCCTTCCCTCCTCCCACTCGTAGCCCGCCCGTCAGGCAGGAAGGCTGGCAGTGGTTCTACCGGCGGTTAATTCTCTCCTCTGTGTTGTCCTC
	CTTCCTCGTTCCCGATCGCCGGCGGGGGCGGCTACACGGGCGGCAGCGCGGTTCCTGCGGGAAGCGCAGCATAAGTCGAGCGGCAGCCGCGAAGCGTCGA
	ACCGAACgcggcggcggcggcggcggcggcggctgtgcagccaacatggcggcggcggcggcggcggGCCCGGAGATGGTCCGCGGGCAGGTGTTCGACG
	TAGGGCCGCGCTACACCAACCTCTCGTACATCGGAGAAGGCGCCTACGGCATGGTTTG
Exon2 17015991 - 17016173
	CTCTGCTTATGATAATCTCAACAAAGTTCGAGTTGCTATCAAGAAAATCAGTCCTTTTGAGCACCAGACCTACTGTCAAAGAACCCTAAGAGAGATAAAA
	ATCTTACTGCGCTTCAGACATGAGAACATCATTGGCATCAATGACATCATCCGGGCACCAACCATTGAGCAAATGAAAGATGT
Exon3 17018379 - 17018568
	ATATATAGTACAGGACCTCATGGAGACGGACCTTTACAAGCTCTTGAAGACACAGCACCTCAGCAATGACCACATCTGCTATTTTCTTTATCAGATCCTG
	AGAGGGCTAAAGTATATCCATTCAGCTAACGTTCTGCACCGTGACCTCAAGCCTTCCAACCTCCTGCTGAACACCACTTGTGATCTCAAG
Exon4 17023545 - 17023661
	ATCTGTGACTTTGGCCTTGCCCGTGTTGCAGATCCAGATCATGATCACACAGGGTTCTTGACAGAGTACGTAGCCACACGTTGGTACAGAGCTCCAGAAA
	TTATGTTGAATTCCAAG
Exon5 17026119 - 17026233
	GGTTATACCAAGTCCATTGATATTTGGTCTGTGGGCTGCATCCTGGCAGAGATGCTATCCAACAGGCCTATCTTCCCAGGAAAGCATTACCTTGACCAGC
	TGAATCACATCCTGG
Exon6 17026451 - 17026582
	GTATTCTTGGATCTCCATCACAGGAAGATCTGAATTGTATAATAAATTTAAAAGCTAGAAACTATTTGCTTTCTCTCCCGCACAAAAATAAGGTGCCATG
	GAACAGGTTGTTCCCAAATGCTGACTCCAAAG
Exon7 17035535 - 17035644
	CTCTGGATTTACTGGATAAAATGTTGACATTTAACCCTCACAAGAGGATTGAAGTTGAACAGGCTCTGGCCCACCCATACCTGGAGCAGTATTATGACCC
	AAGTGATGAG
Exon8 17035683 - 17035744
	AGTCGTCCTAGAACAGAAGCCCTAGCCGTGTCCTTGTCAAGATTTTCCTAAGGAACATTATG
Exon9 17035763 - 17035816
	CTTGGAGTTCCTACCTGTAGGCCCTTGGTGTTTGCCTCAGAAGAATTCCTCCAG
Exon10a 17038407 - 17038532
	CCCATTGCTGAAGCGCCATTCAAGTTTGACATGGAGTTGGACGACTTACCTAAGGAGAAGCTCAAAGAACTCATTTTTGAAGAGACTGCTAGATTCCAGC
	CAGGATACAGATCTTAAATTGGTCAG
Exon10b 17038533 - 17039146
	GTATCTAGAACTTTAACTATACAGTTAACCCTTTATAGCAAGGGAGAGATGGTGTAAGTTAAAACATCTCTAGGAGGAAAAAAGAATTCAGTTTGTCCCC
	TTCCATTGATAGATCATTCATTCTGATTGCTTCATGGTGTGAAATGAGGATGTTAGGCTTCGTCTTTCACAGATTATGAGGACATGAAATAAAGTGGCAG
	CCCTTAGACACTGTGACGGTCGTGTGCATTGTGGGAGTGGACTTTTATGGAAGAAAATAACTCATGGGAAGGAATAGCTTTGAGTCATTTATTCCCAAAA
	ACTTGATTTTACTTCATATGACATTTTAAATATTGAGAAATTCTATTGTGTAACTTTTGTGGCTTTGGGACTGTGTGGttgtttttttggttagttgtgg
	tattaggaattgaatccaaggcctcttgcatgctaagcaagtgctgtaccactgagctacactcagTGTAGATTTGAGAAGAGGGAGTTAATGGGGGAAG
	GGAAAGGGGGTAAGAAGGTAACGGATGAATATGCTCAAAATACATTTTACATGTATGAAAATGTCAGTGAAACGCATCATTATGTATAATTAATATATGC
	TAATAAAAACATTT
Exon11a 17043779 - 17043862
	GACAAGGGCTCAGAGGACTGGACGAGTTCAGATGTCGGTGTCCCCCCAGTTCTTTACCCTGGTCCTGTCTTCAGCCCGTCTCAG
Exon11b 17043863 - 17047546
	CTTACCCACTCTTGACTCCTTTGAGCCTTTCAGAGGGGCAGTTTCTGGTAGTAGCAGCTTTTATACTTTCACGGAATTCCTTCAGTCCAGAGAGTTCTGG
	CAGCAGGCCGTGCAGCAGTGTGCACTTTCAATGCACTTAACTGCTTACTGTTGTTTAGTCACGAACTGCTTTCTGGTTTGAAAGATGCAGTGGTTCCTCC
	CTGTTCTGAATCCTTTCTCCATATCATGTGCTGAACCATCAGCCTCATCAGAGGGAGAGTCTTTCCAGACTTGTTCCAGTTACTGGCACCTCACTTCACA
	GTAGGGAGGCTAGGACATAAGGCACCTTAAGTCAGTGACAGCTCCAAATTTGCACTTCATCTGTTGGCTAGTAACTGTCTACCTAGACAGTAGGAGCTTG
	TGGGTATCCCTGGATGGTATTACAGGCTACAGGGGCAGGGGCTTCTGTTGCAGGAGTCCTTTGGGGCTATTTTCCTGTGTATCATGTTAGTCCTAAATTT
	AAGGTATGTACTATTTGCCCAGCTTTTTAAAAATTTGATCATTGTTTAAATGAAATAGGAAGGAAGCATTGCACCAGCAGTATCTGTTGTTCTGCAGATT
	TTATATGGTTACTTGTATCGTAATGGAGGTGGAGCTCTTGCCAAAATGTTACATGCTATCCTTAGCCAGAGAGTGAAAGTAACAGCTGTGCTTGTCATTT
	ACTGAAAGGTGGACACACACAAAGCTGTGGAAGTTTCCAGAACAGTAGAGAGCAAGCTGACCTAGATGTTCAGGGCAGAGCTCCATATAACCTTGAACAG
	CCACACAGAAGGCTGTTTGCGTAACCACATTCACTACCTAGGGATTTAGCTAAAAGGAACACTGCATCTTTAAATGAGAAAGTGTACAGTTCTTCTCCTG
	CAGCATGTCAGCATCTCGAGCTCACTTTTCAGCAGTGTAATGACTTGTATGTAATAAAGCCTTGATGGGCTCTCCTCATGAAGCTCTGCTCTGTTGCCAA
	GTTAGAGATGTTTCTGGTACTGCTGAGTTAATGTCATAAAAGGCTAGCAGTAACTGTTCGAGCTCTCTTTTATTTCCTTCTCTCCTATATTTTGTTCCTG
	CACTGTGTGCTGTGGAGTTGATGGTGTTATCCCAGTGCGGTGCCTCCAGACCCCCTCACTGCTCTCTGATGAGAAATATGCCTTGTTCAATACTTACTGT
	GCTCTTGCATGACTGTTAAGGTTTCTGTGCAGAGACCAATGTCCAAGTGTCACATCCTTTGATTGAACGAAATCTGTTGTGACCTCTGAGTTGTATTCCA
	TGAAGAGAATGCTACCCAGAAGATAATGTAGAAAAGATAATTATATTGTTAACTTTTCATTTCTCAGCTGTCCTTTTGTTTTCTTGGTTTTTATTTTTTA
	TTTTGACATCAATGGAAAATGGGTTCTATAAAGACTGCCTGCTAGTATGAACAGCAATGCAATGCACTTGTAACTCATGGAAATAAATGTACATCTTTAT
	CTTTACACCCATGATAAGATTCAGTGTTGATTTTCTCTGGATTGGTGTGTCCTAAGTAGGCACTCATAATCAATTTATGGCTTGTGCTTCAGACAAAAAT
	GTTCATGGGCCTTACTCTACTTCTCCCCACTCCACCCTACCCCCCATGCACTGCCCCTCACAGCAGTTTACGTATATGGCTGGGAAAGGTCCTTTTCagc
	tgcacatggtgccatgcatcgttaatcccagcattcagaagtcagaggcaggtggatctctgaatggaagcaggcctgatttgcatagggaggtccaaga
	cagctggaactctataggtcctgtctcaaaaaaaACAGAGTCCTCCCCGTCTGCCTCTCAGCAGCAAATGAATCTGACATGATCCTCTCTAAAACAGGTC
	TCAAGTAGTCAGATGTTGATGATGGCACCCAAACATGCCCAAGTTAGGATCTGGTTCCCTCTGAAAAGGGCCTTCTTGCCTCTGTATCCTAGAGCTGTAG
	GAAGGGCTGTTCAAGATCTCATGTACCTGCTACCAAGTTCAAGGTAGCACATACCTCACCTGGCTAAAGAATGGCTGACTCATCCCAGAAACCAGATCTC
	AGTTCTTGGCCTAAATCCCTGCTTTTCACTTCCACACATGAAGCCCACTGGCATTGAAGGAATAGAGGTTCAGCTTTCATTGATACAGTAGTGGTCAGTT
	TTCCTTTTTCTTTTTGTCTTTTTTTTTAAAGCACTGACTGTTCTCCTACTTGTTTCTTTTTCATATTTTTAATCCCATGAGATTAATTTGCATTCTTGTG
	AATAAGGAAACCATAGCCTCATCTTCTCGAGGTCTGAGCTTTCTGCCCTTCCTGGCACTGTGGAGAGGGGTTGGTGTGAGATCACTCACTTCATCCTAGT
	CACTGTATCACAAGTGTGGCTTTCATGTAGCCATTGTAAATGACAGCTCAGAGCTGTCAGGTATAGAAACGCTCATTATTTTGGTTCTCATGTTTCTAAA
	AATGTTTGGATAACGTCATCTGCATACTGGTGTCATTGGGTGCCTCTACTATTCATACACATAGATAAGCTGTCTGGTGGATGGGCTTTTTGTCCAAGTC
	TTAATATGTGAGGGAAAAAAACCCAAAAACATGAAAACATTTAGCATGAAGAAGATAGCTATCCAACAATCCCAGAGCGCTTGATGATACCGGCATTCAG
	AGCTGACACTGACCTACTCTGTGGTGCATTTATTCTGCCCCCACCCTCATCCCTCTCATTTGAGGACAGGCAACACTTGGGCTGGGCATGACTGTTAGTT
	TTGGGAAGCTGTGAATTAACAGCAGCTATCTCTGAGGAATCACAAAGGTAGACACCTACACTGCATGCCACATAGTATTCAGACCACTTAGGGAGACTTC
	CATTTGCTTAGGATAATATTTACATTAATATTAGTAGTTAGGTTTGAACTTTTGGTGACTTCTATACTACGGTAACACATTCATATATGCATATGCTTTG
	GGTCCTTCATACTACTTTTATATTTGTAAATCAGTGTTTTGGAGCAATTCCAAGTTTAAGGGAAATATTTTTGTAAATGTGATGGTTTTGAAAATCTGAG
	CAATTCTTTTGCTTACAAGTTTTTTTAAAGCATTTGTGCTTTAAAATTGTGCTAGTGTTTGGAATATGATACCCTATAACCCAGATAAGAAACATAAGAA
	TGGAGTAAACGCTGTCGCTTGTCGTGCTATGCCCAGCTTGGCGTGCTGGATCAGCAGTGGGACTCCGGAGTCCCTAGGGTCACACCAGCTCACCTGCAGC
	TTGTTGCCTTTCTGTGCCGTCCGCCCGCCCTTCAGAGCACTCCAGAAAGTTCTGACATGGCTCTGTATCTGCTCTGTACTGTGGATGCCTTTTTGGTGTT
	GTATCCCAAACTGCATAGATTATTTAGGATAATGATAAGTTTAAAAAATTAATGTTGAAGAAAGATTTTATTAAGAATTTAAATGTTTTTTCATTATATT
	GTTAAACTTGAACATTTATCTGTGGCTTATGTGATTTGGTTAATATGTATAAAAATTGTAAGAGGTTTATATTTCATCTTAATTCTTTTGATGTTGTAAA
	CGTGCTTTTCAATTCATTATTTGAATGTTTATGGCACCTGACTTGTAAAAAGAATTACAAAAAAAAAAATCCTTAGAATCATTA

Links between exon parts

From
exon
To
exon
Splice
sites
SupportExamples
12+90dbEST_BB648734.1,dbEST_BU055431.1,dbEST_CJ132460.1,dbEST_BY132289.1,REF_NM_001038663.1,REF_NM_011949.3,GB_AK048127.1,GB_AK132241.1,GB_AK148853.1,GB_AK087925.1,GB_AK035386.1,GB_BC058258.1,GB_D10939.1,GB_X58712.1,GB_AK216848.1,GB_AK205643.1,
23+86dbEST_BB648734.1,dbEST_BU055431.1,dbEST_CJ132460.1,dbEST_BB659323.1,REF_NM_001038663.1,REF_NM_011949.3,GB_AK048127.1,GB_AK132241.1,GB_AK148853.1,GB_AK087925.1,GB_AK035386.1,GB_BC058258.1,GB_D10939.1,GB_X58712.1,GB_AK218813.1,
34+81dbEST_BY745841.1,dbEST_AI746873.1,dbEST_BU841216.1,dbEST_CX233022.1,REF_NM_001038663.1,REF_NM_011949.3,GB_AK048127.1,GB_AK132241.1,GB_AK148853.1,GB_AK087925.1,GB_AK035386.1,GB_BC058258.1,GB_D10939.1,GB_X58712.1,GB_AK193161.1,
45+75dbEST_BG923284.1,dbEST_CX234952.1,dbEST_BI153022.1,dbEST_EL607275.1,REF_NM_001038663.1,REF_NM_011949.3,GB_AK048127.1,GB_AK132241.1,GB_AK148853.1,GB_AK087925.1,GB_AK035386.1,GB_BC058258.1,GB_D10939.1,GB_X58712.1,GB_AK193200.1,GB_AK209313.1,GB_AK210736.1,
57+2dbEST_CN713778.1,NIA_E0627A02-5,
56+77dbEST_CX234952.1,dbEST_BI153022.1,dbEST_BG870441.1,dbEST_CB527569.1,REF_NM_001038663.1,REF_NM_011949.3,GB_AK048127.1,GB_AK132241.1,GB_AK148853.1,GB_AK087925.1,GB_AK035386.1,GB_BC058258.1,GB_D10939.1,GB_X58712.1,GB_AK193200.1,GB_AK209313.1,GB_AK210736.1,
67+88dbEST_CN537279.1,dbEST_CB522595.1,dbEST_CB519686.1,dbEST_CD776799.1,REF_NM_001038663.1,REF_NM_011949.3,GB_AK048127.1,GB_AK132241.1,GB_AK148853.1,GB_AK087925.1,GB_AK035386.1,GB_BC058258.1,GB_D10939.1,GB_X58712.1,GB_BC006708.1,GB_AK211534.1,
710a+112dbEST_CN537279.1,dbEST_CD776799.1,dbEST_BI112246.1,dbEST_BG518797.1,REF_NM_001038663.1,REF_NM_011949.3,GB_AK048127.1,GB_AK132241.1,GB_AK148853.1,GB_AK087925.1,GB_AK035386.1,GB_BC058258.1,GB_D10939.1,GB_X58712.1,GB_BC006708.1,GB_AK211534.1,
79+3dbEST_CA579685.1,ENSMUST00000129477,NIA_K0741A05-5N,
810a+2dbEST_BU937262.1,ENSMUST00000145409,
910a+3dbEST_CA579685.1,ENSMUST00000129477,NIA_K0741A05-5N,
10a11a+67dbEST_CF749894.1,dbEST_CN538848.1,dbEST_CB192709.1,dbEST_CN456121.1,REF_NM_011949.3,GB_AK132241.1,GB_AK148853.1,GB_AK087925.1,GB_AK035386.1,GB_BC058258.1,GB_BC006708.1,GB_AK211534.1,
11a1-1dbEST_AA543567.1,