NIA Mouse Gene Index (mm92)

Exon structure for U017089

chr16 +

Exon1a 37868301 - 37868661
	CCGAGCCCCGCGACGCCCGGGCGAGCACAGCTCCCTCACACGGTTCCCGGGAGCGCCAGGCCTCGGCTCCTGCGCAGCGGACGCCGCGCCGTGCGCCACG
	TGAGGCGGAgcccggcccccggagcggcgcgcgcacccggcgccgACCATCGCGTGACTCGGAGGGCGCGCGGGGGTGAGCGCCCGGGCCGTACCGGGCC
	GCGCCGCGCCACTTCCGACGCGGCGCTCGCTTTAGGTTCCGGGGCGCGCCGCCTCGGCTCGCGGGCCCGGGATCCGGCGGGATGGAGGAGGCCGCGCTCG
	GGGAGGCCGAACTCAACTGGTCCCGCCTCAGCGTGTCGGCCGAGGCGTTGGAGTCGGAGCT
Exon1b 37868662 - 37869066
	GGAGGCGCGCGCCGAGGAGCGGCGCGGCGCGCGCGAGGCTCTCCTGCGGCTGCTGCTGCCCTACAACCGCCTGACGTCGCTGCCGCGGGCGTTGGGCGGC
	GGCTTCCCGCACCTCCAGCTCCTGGACGTGAGCGGCAACTCGCTCACGGCGCTGGGGCCCGAGCTGCTGACGCTGAGCGGCCTGCGCACGCTGCTGGCCA
	GGAACAACCGGCTCGGCGGCCCGGGCTCGCTGCCCAAGGGCCTGGCCCAGTCGCCGCTCTGCCGCAGCCTCCAAGTGCTCAACCTCAGCGGCAACTGCTT
	CCAGGAGCTGCCCGCCTCGCTGCTGGAGCTGCGCGCCCTTCAGACCCTCAGCCTGGGCGGCAACCAGCTGCAGAGCATCCCCGCCGAGATCGAGAACTTG
	CGGAG
Exon2 37877135 - 37877263
	TTTAGAATGTTTATACCTTGGAGGAAACTTCATTAAAGAAATCCCACCAGAATTAGCAAATCTGCCTTCTCTGAATTACTTGGTGTTGTGTGACAACAAG
	ATCCAAAGTGTGCCTCCCCAGCTCTCACA
Exon3 37878373 - 37878650
	GTTGCATTCGCTTCGATCCCTCAGTCTGCACAATAACTTGCTGACTTACCTGCCTCGAGAGATCCTTAATCTTATTCACCTGGAAGAGCTGAGTTTACGA
	GGAAACCCGTTGGTTGTTCGTTTTGTTAGAGATTTAACGTATGACCCTCCGACTCTTCTGGAATTAGCTGCAAGGACCATTAAGATCCGAAGTATTTCTT
	ACACTCCCTATGACCTTCCTGGGAATCTTCTTAGATACTTGGGTTCAGCCAGCAACTGTCCAAACCCAAAGTGTGGTG
Exon4 37881340 - 37888944
	GAGTCTATTTTGACTGTTGTGTCAGACAAATTAAGTTTGTGGACTTCTGTGGGAAGTACCGTCTCCCCCTCATGCACTATCTGTGCTCTCCAGAGTGCTC
	CTCCCCCTGCAGCTCTGCCTCCCATAGCTCCACCTCCCAGAGTGAATCTGACTCAGAAGATGAAGCCAGTGTTGCTGCACACAGAATGCAGAAAGTCCTT
	CTTGGTTGAGCAGCAATGGGTATTGAAAAATATTAAAACACTGAACAGAAATGACTAAAAGGAAATGGGTCTTGAAGTTGATTGGAGACCTGAGCGTTTT
	CATCTTGAGTGTCCATGTAAGACCTGCCATGATGTGAAAGAAAGGTTTTGCATTCTGTCTACACATTCGGCAGGAATGAGTCCAGTTCCCTGTTTAGATT
	CTTTGAGTGTAATTTATTGTGAATGGCAGTTCAAAATTCAGTTGATCGGTCTTAATTTTCATGTAAGTCTTTGAAGAAACACTAACAGGATGGTTCATTC
	TGAAGAACAGGCTTGCCTGTAATCAGCCGGAAGTGGGATCGCCTGGGACAGCTGAGTTGCATAAAGACATCATCACAGTTCTGGTACAAGGGTTGTCCTG
	GTTTATGCTGAACACTAGACATAAAATGAGCCTTCTCCTTGTGTTCTTCTCCTGGACTATTGAAAGCCTTTCTGACCAACTAACAGGACAGTCAGGACTA
	TAACTTTTAAATGGAGTATTAAACCAGCTCTTGTTTTGTGTGTTTGTTACTAACTTTATATAATCTAGCAGTGATATGTTATAGTGCCTTAATCCTAGTA
	AGATTATGGAAGCTTATTATAGAAATTATTTCAGAGCAACCTACAACCTGACACTGTGTAAAACACTTGGAAATATACTTTAACCAATTAGTTGAACAAT
	TGTTTAGATAACACCTGGGTTCTGAGggcctggaactctgtagaatgggctgctctggaactcagagatccaccaggtgggagatcttccaggtggcaat
	tccaggggtcctccacctccctagttgctgagattacaggtgtacactaccaTCTGCTTCCTGCTTCCATGTCCATCTTAACTTCATTTTTGTTTATTAC
	AATGATCTCTTCTAAGTAAACAGCTTTTACACTTAATGAGAATGAGAGGCTAAAGTCTTCATCTGTCTATTCACCAAAAGACAGAATAATAATTTGGGAC
	CAAAAAAATCTAGATGACGGAGTCAGCGTCTACCCGAGAGCACAGCCTTCTTGCAGCTCCTCCGTTGCCGGTCCACACCCCCAGTTCGCCATGGATGACG
	ATGCCGCTGCGCTCGTTGTCGACAACGGCTCCGGCTTCGCAGGCGACAATGCTCCCCTCCCCGGGCCGTCTTCCCCTCCATCGTGGGCTGCCCTAGGCAC
	CAGGGTGTGATGGTGGGTATGGGTCAGAAGGACTCCTGCATGGGCGACGAGGCCCAGAGCAAGAGAGGCATCCTGACCCTGAAGTACCCCATTGACCATG
	GCATTGTCACCAACTGGAACGACATGGAGAAGATCTGGCACCACACCTTCTACAGTGAGCTGCGTGTGGCCCTGTGCTGCTCACCAAGGCCCCCCTAAGG
	CCAACAGTGAAAAGATGACCCAGATCATGTTTGAGACCAATACCCCAGCCATGTCTGTAGCCATCCAGGCTGTGCTGTCCCTGTATGCCTCTGGTCGTAC
	CACTGGCATTGTGATGGACTCCGGAGATGGGGTCACCCACACTGTGCCCATCTACGAGGGCTATGCTCTCTCCCTCACGCCATCCTGCGTCTGGACCTGG
	CTGGCCGGGACCTGACAGACTACCTCATGAAGATCCTGACTGAGCATGGCTACAGCTTCACCACCACAGCTGAGAGGGAAATCGTGCGTGACATCAAAGA
	GAAGCTGTGCTATGTTGCCCTAGACTTCGAGCAGGAGATGGCCACGGCCGCATCCTCTTCTTCCCTGGAGAAGAGCTATGAGCTGCCTGACGGCCAGGTC
	ATCACTATTGGCAATGAGCGGTTCCGATACCCTGAGGCTCTTTTCCAGCCTTCCTTCTTGGGTATGGAATCCTGTGGCATCCACGAAACTACATTCAATT
	CCATCATGAAGTGTGACGTTGACACCAAGATCTCTATGCCAACACAGTGCTGTCTGGTGATACCACCATGTACCCAGGCATTGCTGACAGGATGCAGAAG
	GAGATTACTGCTCTGGCTCCTAGCACCATGAAGATCAAGATCATTGCTCCTCCTGAGCGCAAGTACTCTGTGTGGATCGATGGCTCCATCCTGGCCTCAC
	TGTCCACCTTCCAGCAGATCGGCTCAGCAAGCAGGAGTAGGATGAGTCTGGCCCCTCCATCGTGCACCGCAAATGCTTCTAGGCGGACTGTTTTACACCC
	TTTCTTTGACAAAACCTAACTTGTGCAGAAAAAAAAAGAGAGACAACATTGGCATGGCTTTGTTTTTGTTTTTTAATTTTTTTTAAAAGGTTTTTTGTTT
	TGTTTTGGCGCTTTTGACTCAGGATTTAAAAACTGGAACGGTGAAGGCGAAGGCAGTCGGTTGAAGCAAACATCCCCCAAAGTTCTACAATGTGGCTGAG
	GACTTTGATTGTACATTGTTTTTTTGATTTTGTCTTTTTTTAATAGTCATCCCAAGTATCCATGAAATAAGTGGTTACAGGAAGTCCCTCACCCTCCCAA
	AAGCCACCCCCACTCCTAAGAAGAGGATGGCCGAGTCCACGCCCTGAGTCCACCCCGGGGAAGGTGACAGCATTGCTTCTGTGTAAATTATGTACTGCAA
	AAATTTTTTAAATCTTCTGCCTTAATACTTCATTTTTGTTTTTAATTTCTGAATGGTCAGCTAGTGTGGCCCCCCTTTTTTGTCCCCCCAACTTGATGTA
	TGAAGGCTTTGGTCTCTCTGGGAGTGAGTTGAGGTGTTGAGGCAGCCAGGGCTGGCCTGTACACTGACTTGAGACCATTTTAATAAAAGTGCACACCTTA
	CCAAAAAAAAAAATCTAGATGACAAGTAGTCTAAGAATACCTGCTTTACAATATTGGAATAAATGAGTGaaagttggacatagttgtgcacaccttcaga
	ccagcacttgggaggtggaggcagaagaacaggacttcaaagttactaggcttcatagtaaatttgaggccaacctgggctacaaacatgaaaacttgtc
	tcgaTATGGATGGGGGGTGGATTTTAACCATCAAGTGTGTCTCCTTTGTTCCTCTTTGTTACTAAACCATGACTTCCAACTACATAAACATGAGCATGAA
	GCAGAGCCCGTTATGTTCATCCACAGTAGAGTAGTTCACAGAGCTAGCATAATCATTGAACACTGAAAAAAGTATTAAGAAAACATTGTATCCTTAAGGT
	GTGAAGAAAAATAGTAACACAAATTATTGTCATTGGAAATTAATACATTTTACTAACTAGTTGATTGGGCAATTAAAAAATACTAAAAGTATAAGCTAAC
	ATTAAAAAATATGTAACTCTCACTGCTGATCATTAACCAACCTGTAATGACAGGAAGCCTAGTTGGTAAGTGCCAAAAGTAGTTTCACATTGTATTAGGG
	CATCAGGTGGTCTCTTCAAGTGTGTTTTATTAGAAGCCAACTGTATGCTCAGAGTAGTTGTGTGTAGGTTTCTTGTATATATTATTTTAGTAGAATATAT
	TAGTAGGTTCTAGGGTAATTCAGGGTTTGTATGTGTGTGTATCACGCCATGAAACACAAGAGTTTCGTGGCTGCAGTTGTGAAACGCTGCTATAGTGAGT
	CCCCTTACCTTTCCCTCGGAATAGTGTAGTAAGATTATTTTTTTTTTTCTTTTTGATTTAGGAATTTTCTTCCTGTGTTTATAGAAGTGATGTTTCTACT
	GCTAATGTAATTGTATGATAGAACATATAAAGTCTTTGTTTATTTCGCCAAGTAAGCATCTGTAAGCTGCAGATTGCAAGGTTGGGAAAAGCAAAGATGA
	CTTGTAAATGCTTTGTAATTAGATCATTTAGTTAAGCAACACTGAACATTTTCTTGGAAAATGCTCAAATTGATGGGACCACATTCTTCTGGATTAAATA
	CTTGTACTTTCTTGACTGATAGTCATCTTGACTTAAGTAGTTTGAGTAGCCTTTTAGGAATTACTTGTAAATAGCCTTGTAAATAGAGCATTTAACCATA
	TGTACCCTTCCTAGCCTCCCAGAAAGCAAGTGTATCGTTTCTTCTTTTATAGTTGTAAATAATCCAGCCAGAGGTAGTTTCTAGCCTGTGCCATATAGAT
	GTTTCCTACGGTGTTCTCTCAACAAAGTGTTTATTGTGGTTCTTTATGTGTATAGCTAAAGTCTATGTGCAGTGTGCTGGGTCAGCGTGGTGGGGATGCT
	GGGGATAGGTACAGAGCCTGGTGCGTGTTAGGCAAGCTACAGTTCATGCCTGGCACAGGTCGCTTGTAATGAAATCTGCAGTTAGCTTTTATATTTTTTA
	GAACTCATCTTAGACCCTATCTTTTACGGAAGTTGCTAGTGATTTCTTAATTTTTTTCTTTCTTTTTCATATTTTTTTAAACTAATGATTAGATGTCAGC
	TTAGTGTAATAGGAATTGGCCATCTGGAAGCTGATCATCTTCTGAAGTCAGCAGATGATCATTTAAGACTGTTAAATGCTATTTGGCCTCATTAGTTATG
	AGTTGCATGTGTATCTAATGAATGCTTAGAGTTTCAGAATCCGCAATTTTTATTATACAGTTAttttcttttcctttttttttctttctttttttttttt
	tttttttggtttttcgaaacagggtttctctgtgtagtcctggctgtcctggaactcactctgtagaccaggctggcctcgaactcagagatccacctgc
	ctctgcctcccaagtgctgggattaaaggcgtgcgccaccaccgcccagcCATTAttttattctctgagacagggcctggctgtgtagcccaggctagcc
	ttgaacttcttatggtaactcttgtctcagcttcccagctgctgggaatacCACATACCCTGCTTTAAATGTTTTACTTTAAAATGTGCCAAAGGTGCCT
	CTTGGTCTAAAAATCTTGATATTAAATGTTATTGCCAATATTAAAAATAAGCGTTCATTATAAATTGTACTTGAAATATATGACATTTTGGGGTGATGTA
	AATAAAAGTAGAGCTCAACCCTTAGTAGTGCAGCACGTCCCTGAGACCAGTTCTAAGAGACGCTGAAATATTGGGTTTAAATGAAGAATCAAGAAGAGGC
	TGTTGGCTGGAATGTTAGATGAAACAAATCTTTTAAAATCAACATGGGGTAGGGAAAGAGAAATCATAGGTACCCAGGCAAATCCCTGAGCCAGTAAGGC
	CCTGTAGAGTAATAATGAATTGTTACCTTAAAATCTTATCACTAACTTTATTAGTATTATTAATTATTACGTTGGTTCCTACTGCTGGGAAGCTGTTCAC
	ATCGCTCCTTATACAGGAGCCAGCAAGCTGTAGGCTTTCTTCAGCCTTGCTCTTCCCAGCTCTGGAGAGTCCCTCCCTGACCTGGTGGTTATAATACAGC
	AGGCGGCCTTGGTTAATGTTTACCTTTTCATTGTGTTTTTGAAAACTACAAATCAAGTATTTAGTAGTAGCTATTTACAAATGTGTTTGCATTCGAGTGC
	TTGTAGATACAACTTTACATGTAAACATGTGTAACATTATTTAGCTACATTGAGTTTGTAAGTGCCTTTACCTAAATGATTTGCCTTTCATCAAAAAGTA
	GACATTCTATTATAAGTATTGCTCTTTGTTTAGTGCAAAATACGGAGTTCTTAAGTTAGACTGGGCATGTAACACAGTGAAGGTGCTGTGTAGGCTTTTA
	GGCGGCATGACCTTTAGCGCATAGTTCTATGCCAGTGCTTAAATAGAAGTGTTTATTTATCCTTCACTAGTTATACATTAGGCATATAATGTTATGTGAC
	ATTAACTCAGTAATGTGTGGTTTTATATTTCTGACATAGTGTGATCTTTTTAATAGTACCGTAGGTATCGTGTCCTTTGTGATCTTCCATTTAGCCCTTA
	GTGTGGGAAAGAAAGTATATGGTAAATTGTTGGCAATAGCTATATGATGCGTATTTGACTTGAGGGAGAAAGACTGCTCCTGAGAGGTTCCTCTGCCCAC
	AACAGATGTAGGAAATCTTCATCATGCTGTGCCAGGAAGATCAGAGCCCTCCAGAATCAAGGATGGAGCCCTACCACTACCACCCCACCCCCCAGTCAAA
	CGGTGTATCTTTTACCTAGAATTTTATTTAAAATGTATTTGCTACCACAAAGGATAAGAGAAGTTCCATCCTCTTATGAAAACATTGTTACTGAGGTCTA
	GCGAGTTTCAGCAACAGTTTTCCTATAGGTTGAAAAGGGGGTCGTTTAATAGGAATAAAAACCTCCATTCTTTTTATATTTTTTGTGATCTGTATTTACA
	AAGGATTGAAGTAAGCATTCCACTAACTCACAGAGTTGAACATTTAGAAGGCAGTTTTATGGTTGCTGTCAGGCTTTTACTTTAGTCAGTCTCAATGAGT
	GACATAATATGCAGTCTCATGTATGTATTGAATTTAGTGGCTTAATGAAGGCTATTTACATGCAGAAAGCTATCTGCATTCATCATAATATACTTGATTC
	TTTCAGCCATAAATAAATTGAATATAACTGTATTATTTAAAACTCTAGCTGGAGGAGTCTTAGATGAGTTGGCATTGCTGTTTGCTGGCATTGGAGCAGT
	AGCTAAGTTGGTTGGTTTTGTGTACGAGGATGGTTAAGAGAGTCACTGAGCACAGTTTACATGGTCAGCACTGCTGTTGTGAGAAACAGTGTTAACTCAC
	TTGTCACTTTCTGTCATGTCTAGACTTGTGTTGAGATGTGTCACATTCTCAGCCTACTTTGTGTGATAAGCAAAAACATAATGGGAAAAGCTTTTTAAAT
	AACAGGTCTTAGCTTTTTAAAATTGGGGGTTTCAAAAACAACAAGAGATGCTGAAAAGATGTTACCTTTTACTTTGGTCAGATCATTACGTATGCTCTGA
	CATCTTAATTTTCTATACTTAAAGTCTGTATTAGAAATATCTGTATAAGTATATACATAATTAAAATGTAGCTCAGAAATATGATTCAACAGTGGAGTTT
	TTTTTTTCTGGAAAAAATATAGTCCTATTGTATCAGATTTATTTTACTTTATTATGGCTAATATTCTAAAAAGAATGTTTAAGCTATTTTAAATTCTTGT
	GCCTCTTCCCCCAAAGGATATTTAAAAATATGATCTTATATTAACTTTATATTCTTTCTTCATAAATTTTGCCTTAAACATTGTGCCTTGTTTTATTAGA
	ATCTAATTCTGGCTTTTGTAACAACATTTTATTTTAAACAGACATTTACTTTTAAAAAATCCTTATAATGCTTGTATTTGCTATATCACTGCTTATCTGT
	TTATTGAATTTATTGAATACACAACTCCAAACACTAAGCGTGTTTTAGCATTTATTGTATGTACTAGATAAAAGAGAAAATAAAGATACAGTGTGTTCTT
	CTGAG

Links between exon parts

From
exon
To
exon
Splice
sites
SupportExamples
1a1a-1dbEST_BQ961254.1,
1b2+12dbEST_BB651882.1,dbEST_CJ122712.1,dbEST_CJ117440.1,dbEST_BY253791.1,REF_NM_177093.3,GB_AK090204.1,GB_AK049274.1,GB_AK147818.1,GB_BC141007.1,
23+9dbEST_CJ117440.1,dbEST_DV650384.1,ENSMUST00000078717,ENSMUST00000171099,REF_NM_177093.3,GB_AK090204.1,GB_AK049274.1,GB_AK147818.1,GB_BC141007.1,
34+8dbEST_DV650384.1,ENSMUST00000078717,ENSMUST00000171099,REF_NM_177093.3,GB_AK090204.1,GB_AK049274.1,GB_AK147818.1,GB_BC141007.1,