NIA Mouse Gene Index (mm92)

Exon structure for U017682

chr17 +

Exon1 25854113 - 25854222
	GGCAAGAGTGGGCGGGGCGGCTGCCTGGGCTCCCCGGACTCGGACAGCCCAGCCTCACTCCACAGATCCCTCGGCCCTTGTCATCTCTGCTTTTGCTGTC
	TCCTCCAAAA
Exon2 25854473 - 25854526
	GGGGGCGTCTCGGGGTGCACCGGCGGCCGGGCTCCGGCGGCGGCAGCAGCGCAG
Exon3 25855612 - 25855743
	CCTCAGGCTGGCTACCACCGACGCCCCCGACGCCATGGAGGAGTGGGATGTGCCCCAGATGAAGAAGGAGGTAGAGAGCCTCAAGTACCAACTGGCCTTC
	AAGAGGGAGATGTCGTCCAAGACCATCCCCGA
Exon4 25855872 - 25856351
	GCTTCTCAAGTGGATTGAGGATGGAATCCCCAAGGACCCCTTCCTGAACCCAGACCTGATGAAGAACAACCCTTGGGTAGAGAAGGCCAAGTGCACCATC
	CTATGAGCCTGACCCACACTCTCTGTAAGGTGTGACTTTATAAATAGACTTCTCCGGGTGTCTCTGCTTTAGTCCATTCCCTGTGGGAGCCAGTGCGATC
	TGATGTCCTGGGGCAGTGGGGCTACAGCAGGTCCCTGATGTACAGGCTGCGCCGAACAGCATTTGAGACGCCCTCGTTGAACCGGAACCACACCTCACTC
	CTGCCCACTGCCACACCCATGCGCCACTCGTCCGCGTCCTTCTGGGGGGCCTCAACCTCTGCAGGGACCAAAAGGTTTGCACCTCAGCAGACCCCAGCCT
	ATGTCTCCACCCCCTCCCTTCCTTCTGTGACCCATACACACCTCTGCTCGGGACTGCCACTTTCCTGATGACCACACGTC

Links between exon parts

From
exon
To
exon
Splice
sites
SupportExamples
13+49dbEST_AW558024.2,dbEST_AW557780.2,dbEST_BG088514.2,dbEST_BU554843.1,REF_NM_022422.5,GB_AK018778.1,GB_AY029485.1,
23+17dbEST_BU563704.1,dbEST_BU851406.1,dbEST_BU554810.1,dbEST_BU530928.1,GB_AB030194.1,GB_BC048431.1,GB_BC059712.1,
34+69dbEST_AW558024.2,dbEST_AW557780.2,dbEST_BF455959.1,dbEST_BG088514.2,REF_NM_022422.5,GB_AK018778.1,GB_AY029485.1,GB_AB030194.1,GB_BC048431.1,GB_BC059712.1,