NIA Mouse Gene Index (mm92)

Exon structure for U017829

chr17 +

Exon1a 33961517 - 33961589
	GGTACCCAGGAATCCTCGGGACAGAGTCGTCACCAGCGTCCTTCGGAGCGGAAGGAATATGGCGTCCGCTACT
Exon1b 33961590 - 33961625
	CGCGTTATCCAAAAGCTGCGGAACTGGGCGTCTGGG
Exon1c 33961626 - 33961762
	GTGCGTGTGCTGTTCCGATCCGGGCCGGGAAGGATTTGGGTTCTGTACGCCCTTGAATCCTATCCCCCTTAACATCTCCTTAGTTCAGTGGATAATCCAG
	GATCCCTGAATTTGTGACTCCAGTAGTCAGACTCAAG
Exon2 33961990 - 33962076
	cctggctgtcctggaactcactttgtagaccaggctggccttgaactcataaatccgcctgcctctgcctcccgactaggattaaag
Exon3a 33962546 - 33962595
	CAAGACCTGCAGGCGAAGCTACAGCTGCGCTACCAggagatcgccaagcg
Exon3b 33962596 - 33962695
	gtgagcaggccgtgcttgctgccttcatcctgacattcttccaccaaacccaaggctggccatagtggtacagtctttaatcccagcactcgggaaacag
Exon4 33964747 - 33964853
	agtttctctgtgtagcccttggtatcctgaaacttgctttgtagacaaggatagtcttgcattcagagatctgtcttcctctgcttcctgagtactggga
	ctaaaag
Exon5 33966069 - 33966256
	AGGGTGATTTAAAGGGTTCCTGAGATAACAAGGAATTAAAAAGTTCTATGACCTAGTCTTTGGGGGTGGGGAGAAAGGCACTTCAGTTGGGTAATCTGGG
	GCTGTGCTTCAGTGTTAGAGACTACAATTGCTGGATGAGGGATGGTCACAGCTTGGCACTCTGACCTGATTTTCATAAGCATGTGTAG
Exon6 33966304 - 33966340
	AGCATGTCTAGGTCTCTTCTTTGTCTTGGGAACTTCA
Exon7 33966612 - 33966761
	GACCCAGCCACCTCCGAAACTCCCCGTGGGCCCCAGTCACAAGCTGTCCAACAATTACTACTGTACTCGTGATGGCCGCCGGGAAGTTGTGCCTCCCTCA
	ATCATCATGTCCTCACAAAAGGCCCTGGTGTCAGGCAAGGCCGCCGAGAG
Exon8 33975044 - 33975261
	TTCTGCAATGGCAGCCACTGAGAAGAAGGCAGTGACACCTGCTCCTCCCATGAAGAGGTGGGAGCTGTCCAAGGACCAGCCATACCTGTGACCCTGCCCT
	AGGTTACCTTGCTATATATGTCTCTAGGGCCACATGACTGCTTTTCCTCCTTGGACTCCCTCTGGGGAGAGTGTGACCTAATTTGTAACAAATATATAGA
	ATTCCACATTATTTCCAA

Links between exon parts

From
exon
To
exon
Splice
sites
SupportExamples
1b7+7dbEST_AA450667.1,dbEST_BU058713.1,dbEST_BU847177.1,dbEST_BX518947.1,
1b3a+268dbEST_AA270071.1,dbEST_AA465773.1,dbEST_AA404120.1,dbEST_AA277615.1,REF_NM_023202.3,GB_AK002476.1,GB_AK003468.1,GB_BC055698.1,GB_BC052817.1,GB_AK010299.1,
1c3a+2dbEST_BE306995.1,ENSMUST00000174498,
23a+2dbEST_AV500798.1,ENSMUST00000173807,
3a4+1dbEST_AA493052.1,
3a7+274dbEST_AA270071.1,dbEST_AA465773.1,dbEST_AA404120.1,dbEST_AA277615.1,REF_NM_023202.3,GB_AK002476.1,GB_AK003468.1,GB_BC055698.1,GB_BC052817.1,GB_AK010299.1,
3b7+2dbEST_AI036949.1,ENSMUST00000173175,
47+1dbEST_AA493052.1,
57+3dbEST_AW987924.1,dbEST_BE627969.1,ENSMUST00000174847,
67+2dbEST_BE624753.1,ENSMUST00000173556,
78+327dbEST_AA404120.1,dbEST_AA277615.1,dbEST_AA048843.1,dbEST_AA237365.1,REF_NM_023202.3,GB_AK002476.1,GB_AK003468.1,GB_BC055698.1,GB_BC052817.1,GB_AK010299.1,