NIA Mouse Gene Index (mm92)

Exon structure for U017895

chr17 +

Exon1 35331278 - 35331628
	AGTTCAGAGAACCCAGGCATCCAGCCACCCAACCCCGGCCCCAGCGCTGGGTAAACAGGAAGCTGGGTGAGGGGAGGAAGGGTGTTCGGAAAGTCCCCGG
	GCAGGGGGCAGGTGTGTGGGTCTGCGGGGGTGGGGGGGTCTACCCCTGAGGTATGAAAGCCCCTGCCCCGGTCCTAGTTCTGAGTCTGGATGGGGACACG
	GGGACTGCAGGGCCTGGGTGGGAGACCCCAGGGGAGGGGCTGCCTCTTGCTGGCTGTGGCAGGAGCTACTTCCCTGGTGACCCTGTTGTTGGCAGTGCCT
	ATCACTGTCCTGGCTGTGCTGGCCTTGGTGCCGCAGGATCAGGGACGTCGG
Exon2a 35331995 - 35332080
	GTTGAGAAGATCATTGGCTCAGGAGCACAGGCTCAGAAAAGACTGGATGACAGCAAACCGTCGTGCATCTTGCCCTCACCCTCTAG
Exon2b 35332081 - 35332310
	CCTCTCAGAGACTCCTGACCCCCGTCTGCATCCTCAGAGATCCAATGCTTCCAGGAATCTAGCCTCCACATCCCAGGGCCCTGTTGCGCAGTCCTCTCGG
	GAGGCATCTGCATGGATGACCATCCTGTCTCCAGCTGCGGATTCTACACCAGATCCAGGGGTTCAACAGCTGCCAAAGGGGGAACCAGAAACTGACCTCA
	ACCCTGAGCTCCCTGCTGCCCACCTCATAG
Exon3 35332649 - 35333265
	GCGCTTGGATGAGTGGGCAAGGGCTCAGCTGGGAGGCGAGCCAAGAAGAAGCGTTTCTGAGGAGCGGCGCGCAGTTCTCCCCCACCCACGGGCTGGCGCT
	GCCACAGGACGGCGTCTATTACCTCTACTGCCACGTCGGGTACAGGGGCAGGACGCCCCCTGCCGGCCGAAGCCGTGCTCGCTCGCTCACGCTGCGCAGC
	GCCCTGTACCGCGCGGGGGGCGCCTACGGGCGAGGTTCCCCCGAGTTGCTGCTGGAGGGCGCGGAGACAGTCACACCTGTTGTGGACCCCATCGGGTACG
	GGTCGTTATGGTACACGAGCGTGGGGTTCGGCGGCCTGGCGCAGCTCCGGAGCGGCGAGAGGGTCTACGTTAACATCAGTCACCCCGACATGGTGGACTA
	CAGGAGAGGGAAGACCTTCTTCGGGGCGGTGATGGTGGGGTGACAGCCATCTGTATTCATTCCTGGAGGATCGACTGACGGTGCGAATGTGTGAATCGTG
	ATGTCCGGGACCCCGACAGTCCCGAgcggccgggggcgtggcgggggggggggAGAACGGAATGTAGGACACGAATTTTGAAAATAAAGAATGTAAACTA
	TGCCGGCCCTTGCCAGT

Links between exon parts

From
exon
To
exon
Splice
sites
SupportExamples
12b+1ENSMUST00000173600,
12a+27dbEST_AA510152.1,dbEST_AA216919.1,dbEST_AA209859.1,dbEST_AI121459.1,REF_NM_008518.2,GB_BC160367.1,GB_U16985.1,GB_BC064062.1,GB_BC114919.1,
2b3+22dbEST_AA510152.1,dbEST_AA216919.1,dbEST_AA209859.1,dbEST_AA880085.1,REF_NM_008518.2,GB_BC160367.1,GB_U16985.1,GB_BC114919.1,