NIA Mouse Gene Index (mm92)

Exon structure for U019176

chr19 +

Exon1 11591002 - 11591035
	cacaagacaacccacctagaagaacttattccag
Exon2 11592943 - 11593164
	TTACTGGGACTTTCTGATATAGGAAGTACAGGCACAATAACAGTCCTCAACCTGTTAAGCACCACTTCCTGTGCAGTGAACACAGAAGAAGGAAGGGCTG
	GAGACAGTTACAAGTTCACAAGAAGGAACCAAGGATCAGCCTGAGAGAACCCAGAGTTAAGGCTCTTCGGGTTCCTGAGAGCTCGGCTGGAAGTGACTGG
	GTGACAAGGCACACAGGCTCAG
Exon3 11594813 - 11594975
	CCGTGGGAGCTCAATCATGATTCCACAAGTAGTGACCAGTGAGACTGTGGCAATGATTTCGCCAAATGGAATGAGTCTTCCCCAAACAGACAAACCCCAG
	CCTTTCCACCAGTGGCAAGACAGCCTGAAGAAACATCTAAAGGCTGAGATCAAAGTGATGGCG
Exon4 11596161 - 11596295
	GCAATCCAGATCATGTGTGCTGTGATGGTGTTGAGTCTGGGAATCATTTTGGCATCTGTTCCCTCCAATCTACACTTTACCTCAGTGTTTTCAGTCCTGT
	TAAAATCTGGCTACCCATTTATAGGAGCTTTGTTT
Exon5 11598400 - 11598456
	TTTATAGTCTCTGGAATTCTGTCCATCGTCACGGAGACAAAGTCAACAAAAATTTTG
Exon6a 11601111 - 11601189
	CTGCTAATGAAGCCAAATAACAAGAATTGCTGCACCATTTTGGAAGAAAGGTATAAATGAAACGTGCTGCTTCTTCCAG
Exon6b 11601190 - 11601387
	GTAGACAGCAGCCTGACTCTGAATATCCTGAGTGTTTCATTTGCTTTCATGGGCATCATTATCATCTCTGTCAGCCTGGCTGGTTTGCATCCTGCCTCAG
	AGCAGTGCTTGCAGAGCAAGGAGCTTAGACCAACTGAATATCATTACTACCAATTCTTGGACAGGAACGAGTGCTTTGCCGCCAAGTCTGTTCTGGCT
Exon7 11603064 - 11603165
	GGAGTCTTTTCACTGATGCTGATCAGTACTATGTTGGAACTTGGCCTGGCTGTCCTCACTGCCATGCTGTGGTGGAAACAGAGTCACTCTAACATCCCTG
	GG
Exon8 11603978 - 11605746
	AATGTTATGTTCCTGCCACATAGCTCAAATAATGACTCCAACATGGAATCAAAGGTACTTTGTAACCCCTCATATGAGGAACAATTGGTTTGTTAAGAaa
	aacaaaacaaaacaaaactaaataccacaaaaACAAATGGAACTATACCGCAGAAGATATGTCTTCATGATAATGCAGAAATTCCAACCATCACAGGGTA
	GCAATGCTTGCTACTTAAAATGTAGACTGTTCATACAGTGGGTACCAGTATGAGTTGAATGTGTGTATTACTGGCACCCTATTGATTTTCATGACCTTGG
	CTTCAGCCAAAGCCCAGACCTACAAATGGTGGCCTTTCTTAGAAAACCAAACAGAATGTTTCAGGCCATTGTAGTGGGGAAAAGGGACAACATTTTCTTG
	CCCCCTGCAATTAACAGCAACAGTTAACCATTAGCAGTCTTTGTATTCAGAATCTCTGCTATGACGTGGGTCTTCTATCATATCAGTTTTATTCACTGGT
	GTGAATAAACAAGGGACCTGCAATGAAGTCTGAAGAAGTTTCCATGTTGTTGGTTCAAAATAAAGTCTTTTTGTGATTGTATATTCTTTTTGTATGGGGT
	TTTGTGTGGGTTTTGTTGTTGTTGTTGTTTTGCTTTTATGCACAGATCAAGTCCTCAGTGGTACATAAACACATGTGTTTGCTATTTTTTTTTTGTTCTC
	TATCAACCAAAAAAAAAAAAAAAAAAGGCATGGGAAAGAGAAAAAGGAATATATCtgtgtctctgtgtttatgtggtgtgtgtgtgtgtgtgtTTTAAAC
	TAAAACTGAATGAACATTCAAAGTTTAGCAATGTATTTTGGAGGTACCAGATAACATACTTATTTCTAGAATCGCCAGAGCAAATGAGAGACATTTTGTC
	GCTTCTTATAAgaggctacagagatgtctcagaggttaagagcattgattggttctgtgaggacatgagttttattattagcatacacttggtagctcac
	aaacttgtataacttcaatcccaggtgatctgatgtccttttctggccttggtgggcagtagacacacatgtaaaacacatacagacataaattcatgta
	aaatacccataaacataaaatttatttaaaataaaattaatagtaaaatatGGACTGTGGGGAGTGATAGTACAATTAGGATCATATTCTATAAGACATT
	AAGGTCTAGATAATTGATGCATAAATTTTATCATCATGCACACATATCTGAAATATACATTTCCAAATTGATACATAAATATTTATAATCATTCACACCT
	GCCAGAATTGTACATTTTCAAAATTCTGAAAGCCATGAAAATTGTAATTTATGAAAGCAATATCTGTAGAATTCTGTTTTTCTATTTTCCTTTTACACTG
	TAAATATCAGTAGTTGGTAAATAAAAAAGATTGAAGAGACTTCAGGCTGAATCCTATCCAATTTTGAATCTACTTTATTTCCTTATCTCCAATAAAATTC
	TCCACATTCCATGAGAATGATGTTTCTCCTAGAAGTAAATTAATGATATTTTCTGAATGAAGAATAAAGCACCTGGTATGAAAATGTCTGCCAGAAATTA
	TTATGTGTTAATAAGAAAGTACTCTAAAATGTATCTCTTTTCTATCACTTGAGAAGTCAATTCTTGTGTTCTTCTTAGTTTATAAATATTTTGGGCTTCT
	TCTTCTCTGTAAACCTTGTGACTTGTTGTGGTTTGAACATGTAATAAATCTCAAAGGTTCATCTGTTTC

Links between exon parts

From
exon
To
exon
Splice
sites
SupportExamples
12+2dbEST_BE137224.1,ENSMUST00000163078,
23+42dbEST_AI391038.1,dbEST_BB574866.1,dbEST_BB609730.1,dbEST_BE137224.1,REF_NM_027209.3,GB_AF237909.1,GB_AK172345.1,GB_BC027425.1,GB_AK075671.1,GB_AK007613.1,
34+45dbEST_AA967282.1,dbEST_AA763361.1,dbEST_AI391038.1,dbEST_AI037382.1,REF_NM_027209.3,GB_AF237909.1,GB_AK172345.1,GB_BC027425.1,GB_AK075671.1,GB_AK007613.1,
45+40dbEST_AA967282.1,dbEST_AA763361.1,dbEST_AI391038.1,dbEST_AI037382.1,REF_NM_027209.3,GB_AF237909.1,GB_AK172345.1,GB_BC027425.1,GB_AK075671.1,GB_AK007613.1,
56a+9dbEST_BU694245.1,dbEST_BU698156.1,dbEST_BU696609.1,dbEST_BU699065.1,GB_AK172345.1,
56b+28dbEST_AA967282.1,dbEST_AA763361.1,dbEST_AA170213.1,dbEST_AI391038.1,REF_NM_027209.3,GB_AF237909.1,GB_BC027425.1,GB_AK075671.1,GB_AK007613.1,
6b7+12dbEST_AA170213.1,dbEST_AA178552.1,dbEST_BG694653.1,dbEST_BY707659.1,REF_NM_027209.3,GB_AF237909.1,GB_BC027425.1,GB_AK075671.1,GB_AK007613.1,
78+12dbEST_AA170213.1,dbEST_AA178552.1,dbEST_BY707659.1,ENSMUST00000163078,REF_NM_027209.3,GB_AF237909.1,GB_AK172345.1,GB_BC027425.1,GB_AK075671.1,GB_AK007613.1,