NIA Mouse Gene Index (mm92)

Exon structure for U019329

chr19 +

Exon1 27290974 - 27291438
	AAGCCACAACCGCGGGAGCGCTCTTGTTCTTTCTCTCTTTCTCTTTCACACACTCTTACTTAAAGCCACATTTAATTTTTAACAAAATGGCATCTCAGCT
	TGCCATTGAGATGGGACTCCGAACCCCACAGCAGAACAGCGGAGCTTTCGCACCCCTCCTCTTCATCACTTTCAGGTTGGAAAGAAGAGTCCCCCGGAAG
	ATGCTACCTACCGACCTCACTACATCAGCCCTTCCTAGGGGCTCAGGAGAGGGAGGAAAAGGGTTCCTTGCTGCCCCCCAGACCCCTCAACTGCCAGCCC
	CATCAAGCCTGGAGGCGGTGGCAAGAGCAGCAATAGTTGCATCAGCGCTCCTAGCCAAGGCGCCAGGAGGGTACAGTAGCAACTGTAGGGAGCTAGGGAG
	CGCACAGCTGCTGCGGCCGCAGGTTCCCTGGATCAGGAAATTAGGACAGGCACCCGGGATTGGAG
Exon2 27291510 - 27291622
	AGTCGAGCCCCTGGAGCCATCCGGATGGCGGCGGCGACAGCCCCAGCCCCAGCCACTCACGCACGCACGCTGCCACTTGCCCCCGCACCCTCCTCACTGC
	GCGCGGGAGAGCG
Exon3 27292033 - 27292186
	GGCTGGTAACTTGTTGTGCGGAGCGAACGGCGACAACGACGGCGCGACGGAGGCACCATCCGGGCGGGCAGCATGGGCACGTCCGCGCGCTGGGCGCTGT
	GGCTGCTGCTCGCGCTGTGCTGGGCGCCCCGGGACAGCGGCGCCACTGCAAGCG
Exon4 27304686 - 27304805
	GGAAGAAAGCCAAATGTGATAGCTCCCAGTTTCAGTGCACAAATGGCCGCTGCATTACCCTGCTGTGGAAATGTGATGGAGATGAAGACTGTGCGGATGG
	CAGCGACGAGAAGAACTGTG
Exon5 27306210 - 27306260
	GAGCCAGCAACAAAGCTGCAGACAGATGTGTTTAATTTATCCCACCTCAAG
Exon6 27309280 - 27309402
	TAAAGAAGACGTGTGCTGAGTCTGACTTCGTGTGCAAAAACGGCCAGTGTGTTCCTAACAGATGGCAGTGTGACGGGGATCCTGATTGCGAAGACGGTTC
	TGATGAAAGCCCTGAACAGTGCC
Exon7 27310730 - 27310852
	ATATGAGAACATGCCGCATAAATGAAATCAGCTGTGGCGCCCGTTCTACTCAGTGTATCCCCGTGTCCTGGAGATGCGATGGTGAAAATGATTGTGACAA
	TGGAGAAGATGAAGAAAACTGTG
Exon8 27312543 - 27312914
	GCAACATAACATGTAGTGCAGATGAGTTCACTTGCTCCAGTGGCCGCTGCGTCTCCAGAAACTTTGTGTGCAATGGCCAGGATGACTGTGACGATGGCAG
	TGATGAGCTGGACTGTGCTCCACCAACCTGCGGAGCCCACGAGTTCCAGTGCAGCACCTCTTCCTGCATTCCCCTCAGCTGGGTGTGTGATGATGACGCA
	GACTGTTCAGACCAATCAGACGAGTCTCTTGAGCAGTGTGGCCGTCAGCCTGTGATACATACCAAATGTCCTACCAGTGAGATCCAGTGTGGCTCTGGCG
	AGTGCATTCACAAAAAATGGCGGTGTGACGGAGACCCTGACTGCAAGGACGGCAGCGATGAGGTCAACTGCC
Exon9 27313000 - 27313122
	CTTCTCGAACCTGCCGACCTGACCAGTTTGAATGTGAAGATGGTAGCTGTATCCACGGCAGCAGGCAATGCAATGGCATCCGAGACTGTGTTGATGGCTC
	TGATGAAGTCAACTGCAAAAACG
Exon10 27313214 - 27313336
	TCAATCAGTGCCTGGGCCCTGGAAAGTTCAAGTGCAGAAGCGGGGAATGCATAGACATGAGCAAAGTATGTGACCAGGAACAAGACTGCAGAGACTGGAG
	TGACGAGCCCCTGAAGGAATGCC
Exon11 27314112 - 27314231
	ATATCAACGAATGCCTGGTCAATAATGGTGGCTGTTCCCATATCTGCAAAGACCTAGTTATAGGTTATGAGTGTGATTGTGCAGCTGGGTTTGAACTGAT
	AGATAGGAAAACCTGTGGAG
Exon12 27314335 - 27314460
	ATATTGATGAATGCCAAAACCCGGGGATCTGCAGTCAAATTTGTATCAACTTAAAAGGCGGTTACAAGTGTGAATGTAGTCGTGGCTATCAAATGGATCT
	TGCCACTGGCGTGTGCAAGGCAGTAG
Exon13 27314956 - 27315127
	GCAAAGAGCCGAGTCTGATCTTCACTAATCGAAGAGACATCAGGAAGATTGGCCTAGAGAGAAAGGAATACATCCAACTTGTAGAGCAACTAAGGAACAC
	GGTGGCTCTCGATGCGGACATTGCAGCTCAGAAGCTGTTTTGGGCTGATCTCAGCCAGAAGGCCATCTTCAG
Exon14a 27315725 - 27315789
	TGCCTCAATTGATGACAAGGTTGGTAGACATTTTAAAATGATCGACAATGTCTATAATCCTGCAG
Exon14b 27315790 - 27315943
	CCATTGCTGTTGATTGGGTGTACAAGACCATCTACTGGACTGATGCGGCTTCTAAGACTATTTCAGTAGCTACCCTAGACGGAGCCAAGAGGAAGTTCCT
	GTTTAATTCTGACTTGCGAGAGCCTGCCTCCATAGCTGTGGATCCGTTGTCGGG
Exon15 27317555 - 27317673
	CTTTGTTTACTGGTCAGACTGGGGCGAGCCAGCTAAAATAGAAAAAGCAGGAATGAATGGATTTGATAGACGTCCTCTGGTGACGGAGGACATCCAATGG
	CCTAATGGAATTACACTCG
Exon16 27318248 - 27318387
	ACCTTGTCAAAAGCCGCCTCTACTGGCTGGATTCCAAGTTGCACATGCTCTCTAGTGTGGACCTGAATGGTCAAGATCGTAGGATAGTGCTCAAGTCTCT
	GGAGTTCCTAGCTCATCCTCTTGCACTCACCATATTTGAG
Exon17 27318689 - 27318830
	GATCGCGTCTACTGGATAGATGGAGAAAATGAAGCAGTGTACGGTGCCAATAAATTCACTGGGTCAGAGCTGGCCACTCTAGTGAATAATCTCAATGATG
	CCCAAGACATCATTGTCTACCATGAACTCGTCCAGCCGTCAG
Exon18 27320025 - 27320171
	GTAAAAACTGGTGTGAAGACGATATGGAGAATGGAGGATGTGAATATCTCTGCCTGCCAGCACCACAGATCAATGACCACTCTCCAAAATATACCTGTTC
	CTGTCCCAATGGGTACAATCTCGAAGAAAATGGACGAGAGTGTCAAA
Exon19 27321083 - 27321166
	GTACTTCAACTCCTGTGACTTACAGTGAGACAAAAGATATCAACACAACAGACATTCTACGAACTAGTGGACTGGTTCCTGGAG
Retained Intron 27321167 - 27321499
	GTATTGGGTCCAGCACTGCAAACTGTTAATCTCAACTAACTGCCGCTTAAATAATTAGTGCAGCTTTTAACTACTGGTTCTGTCCCAACTGGCTACTTGT
	GCCTAAAGCCCAAAGATTTAGACCCTGCACATCCTGGATTTCTCTTGACTTATTTAAACCTATAGGTTTAATGTAACTCAAATAATTATAAGCCTAAGTT
	CTTCTGATATCTAATTATAATGGATACTAGAAATCAATATTAAGTACAAAGGTATAAGGATCTCTACCTAATTCGTAGATGTCTAAGTCTTAATTCAAAT
	CCTTATAGACTGATTACTTGTATGTCCTTGTAG
Exon20b 27321500 - 27321580
	GGATCAATGTGACCACAGCAGTATCAGAAGTCAGTGTTCCCCCAAAAGGGACTTCAGCTGCCTGGGCCATCCTTCCTCTCT
Exon21 27322347 - 27322516
	TGCTCTTAGTGATGGCAGCAGTAGGTGGCTACTTGATGTGGAGGAATTGGCAACATAAAAACATGAAAAGCATGAACTTTGACAATCCTGTGTACTTGAA
	GACCACTGAAGAGGACCTGTCGATAGACATTGGTAGACACAGCGCTTCTGTAGGACACACATACCCAGCA
Exon22 27323595 - 27328721
	ATATCAGTTGTAAGCACAGATGATGATCTGGCTTGAGTTCTGAACAAATCTTGGTCTATGAGGTCTACACCAATAACACCCTACTCTGGAATGGTAACAG
	AGCCAGCGCTGAAGTCTCCTTTCTTCCTCCCATCTGGAAGAACATCAAGATATCTTTTTGTGGATCAAGTTTGAGTACTTGATCATTTTTATATTACTTT
	TGTAAATATTCTTGGCCACATTCTACTTCAGCTCTGGATGTGGTTACCAAGTATCTGTAACCCTTGAGCCCCTAGACAGTATTGCCATCTCTGGCCAAAT
	ATGCACTTTCCCTAGAAAGCCATATTCCAGCAATGAACCTTGTGCTATAGTGACTCCCACCTGTACATACATTGTATAGGCCACCTGTACATATCCCAGA
	GAACAATCACTATTCTTAAGCACTTTGAAGATATTTCTATGTAAATTATTGTAAACTTTTTCAATGGTTGGGACAATGGCAATAGGATAAAACGGGTTAC
	TAAGATGAAATTGCCAAAAAAAAAAAAAAATTTGTAACTAATTTTGTACGTATGAATGAAATCTTTGACCTCTGTCGAGGTTTGCAAAGACTGACTTCAA
	ACTACTGTACGTTTTTTTCAAGTGCTAAAAAAAAAATTAAACCAAGCAGCTTAACCATGGTTTTGATTATTCCTCTAAGATGAGCTTCTGGGAACAGTAT
	CACCAAATGTCCCAAACATTTAAGCTAGAGTTAGTTCTTGATGTTGTATACCTAAGCCCATAATCGAGCTAGTATCTTGGATGGTATACAACCAAGAACC
	AGCTAAACAATTAGATACAGTTTAATATTTGTACCTCCAAATCTATCActtccttccttctttccttccttcctttcttccCTTgctggcctcaagcttg
	caatgctcctgcctcagcctctcaacttctagaattacatggctgcaccacttcacccagcctatgtagtTTTATTTTATAAATGACACTGTCTTCCAGA
	ATTCCTTTCTTTAACAGATTTCTTTTTCTTACTTTTTTTCCCCATGATCTAGAAACACATGCCAAGATTCTCATGAGTTTTCTTACTTTGTCATCCATGT
	TCTTTTTCTATTTGTAGGTCAAAGACAAGTGCCTTCTATGGCATGGGAAAGGGCTTTATTCTTATAAGAGTCTGGCCTGTCTTAACTAGAAGACGGGTAG
	GAAGGATACTAGGTAGGCAGCGTTGCTGAACAATCTAAGTTgtggttcttagcctgtcccaggaacagcagcatgggaggctaggaacttaacagaaatg
	aggattcttggttctcaccccaaacctacttaatcagaaaccccagtaatacagaccagaaaacagttttcacaaattcctcatgtactttgaatataac
	ataaagttcgacaaAATCTATTCTAATGTGGCTTTTTATGGAGGGTGTAACTGTAATGTATTCAAAATTGTCAGTGTGGTGGCATCAAATATGTAGAGAT
	GGTCTTTCTGTGGAGAATTTGTGGAACTTTAGTGTGGAGAACAAAGAAGGAGTTGGAGATGAAAAAGTGGTACTGTGTCAAGGGAAGATTTTTGTGAGTT
	TTCCATCATGTTGGCCATCACATCCTGACTGAAGTCTCAAGATTCCTGGAAGTGAAGGAAGACACAAAGCTTAAAACTCAGATGAGATGCTCTGACTCCA
	TCGTGAAGTGGTCACTGAAAAAAATGTTGCTGGTTTCTTGGGATGAAAGAACTGAGCCAGCATCTGAAAAAGATCATTTCATTTAAAAACAAAAACAAAA
	AACCTTGTCTCTTCTGTAAAAATCCAACATTAGGTAGAACTTGCTGTAATTTAAAAGTCACAAAGTCATTTATAAAAAATGAAGTGATTAAATATTGACC
	GAGTATTGTTGAGTATTGCTAGAGTAGCTAGTTATCTGGTGAGACTGCTAATTGATTCAGTGTATGATAGTTCACACGGGATGAGAACCTTGGCCTTTAT
	CACCCAAACAAGAACTCTCTATGAGATTGGTTGACGTGAGTTGGTTGAGTCTCTGGAGcatcagttttcaacttctggatcgcaacccctttgggggtgg
	gtaggtcacataacagatatgctgactaacagagattgccattatgatttataacaatatcaaatgtatagttatgaactagttatgaaataatcttatg
	gttgagggtcaccacaacatgaggaactatattaaagactcgtggcattaggaaggttgagaaccactTCTCTAGGGCTCAATGTATTAGATAACTCACT
	AAGGGGTAAAATATGAAATATCAAATCCTAAAAAGGATATTTATAATTAAAACAGCCTGTCATGAGGCAACTGTGAGTGGAACATCTGGGAATTTGAGAA
	GTATCTGCAAAGTATAGAAAAATCAACAGATTTGTGGACCCTGGTAAAGAAGTTCAGCCAAGTCTCAGTGAAAAATGTTAAGAAGTTGATGCAAGCTGCA
	TGCTCCTTGTTAAGATGCAGGCTTTGCATATCACCAGGTCACTTAGAATATTCTAACAGTTACTCTGAAGATGTGTCATGATTTGTGAGCCTTTGGATCT
	GGGTAAATAGAGGACAAAACTAATTCTTTGAGGCTTTAACTTGGGCACTTGCCTTGATTCCTTTTATTATTGGAAGTCAGATACCCCCTCTCCAAAGTGA
	GCAGGCAGGTTTTAAACAGCTTAACTACTGACCAGTTATAAGACTCGCTTTTCAGTCATGGATCCTGCAGAAATCTGAGACCCACCCATATCCTAGCTTT
	TAACTGTCTTCGCTCCACCCTCAAAGATGCTACTGGGCTTCCTGTGCATCGCATTGCTAAAGAGAACTGATTTCCTAGCATTCTTCCCTAGTAAAATCTT
	TCCCAATAGAACAGTATGTTCCCTTAAACCCAAATGAACATCACGCTACTTTCTTTTACCTGTGGCAAAGCAAACAAATTAAAAAAAAAAAATCATACAC
	CCTTTTGCTTACCTAATTTCAAGAACAAAACAAACAACAAAAAAATGCTACTCCTAGTTCAGATGTTGTGCCCTTCATTTCTAAAGCCGATGTTTTGCCC
	TCTTTGGAAAGACTGAGAACTGTGGCCTGATTTCGTCCATATTCTAGACTCTTAAGCTTGTCAAATTCCAGAAATGGAAAAAACTCTGCAAGAGAGTCTT
	GCTTTCAAGGAGAAAGGAAAATGGCTTTGAAAATGAGACAGTCTTTGTGGGTTTTGTCGTTGGTTTTTGTTTGTTTACTTGGTTTTCTCATGTCCAGCAC
	GGAGGTCTCCAGTTCACAAGAGCTTCCTGGGAAGGATAATAATCATGTTTGTAGGAATCTCATTCCCATCGACCTTTACCGATGGAGAGCCAATTGTAAT
	TCTTTTGCCCTAAGGACTAGGGACTCCTAAGTTGAGGGTTGTGATCAGAGGTCCCATCTCTTTACAGTGTCACTTCAATCTGTTTGTGTTTCTGAGCCTG
	GTTCCTCCAAGACACAGGAATGAAGTGGGGCCACAGATTTAGAATCCATTTAAGTTTCCCTGTTGTGTGTCTGTGTTGACCCTGGGACAAGTGTGAGACA
	GGAAGAGTGTGGGGAGTCTGGGCTCGGTAGTAACTCTGGGATATTTCAAGGATGGCTTTCTTTTTGACTGTGCTTGGGAGCAAAGTCAGATGGGCAGCTG
	GGTGTGTGTTTAGAGCTCTACGAATTGTCAATAACACATGCTTCTCTGTCCCAGGGGTCCTAGAGAGGGCAAATTACTAAGCATCTCTGTAGGATGGAGA
	TGATAGGAATTCACTGAGACAATGGCGTGATATAGCAGTGGCATCCAAGAGCTCAGCACAGTGTCTGGCATCTGGTGTGCATGGGCACATGTACTGACTA
	TGACTGTCGGTGTGTGTTGTTATACAGTCCAGGAACTGGTAAGTGCCCTCACCAGCGAGCATGGCAGGTAGCTTCACTCAGTGAGTAGCAAGGGCACTCA
	GCTCTGAGGATCTCAATTCATACAGGTGAAAATCCTTAAAGGACTCTATGATTTAAACTCTGGAGTCAAAGCTAGTGTGTGTGTCTGTCTTTGCTCCTGC
	TAAGACATGGAAACAAGTATTGGAACCTCCAGAGTGTTTAAATGGCTATTGAAATTTATAATGGCCCTTCAATTcttactatatgcttaatagtgtgcta
	aataagtgctcttctgtcttttattagagcttctcagaaaccctaataggcaagtattatcttgattttgcagatgtgaaagctaagacCATGAACCATG
	TGAGATTCCAAACCAAATAAGCTTGCTGCCATGGTCTAGGGTGAGGGTGCTGTCCTGTGCAAATGTTAAGTTGGATATCACACTGTATATTTGCTGAGTC
	TCTTTTCCTATAGGTTTGCAGAGCATGTCTGCAGTTTCTCGGTTGTTATAGATTTCCTACCTAACCGGGATGATGATGCACAGAACTCTAAAGCCAGTAG
	TGTGGCAACAGAATAGCACAGTATAACTCAGTTGAGACATGACTTCAAGACTCGAGACTTGGTAGAATCCTTTTACTTGGCCATCTGAGTAGAAATAGGA
	GTAGCTTTAAGAAAAAGGCAGATTCTCTAAAGGAATTTGGAGATATGACATCACTCCTGAGCAGAGCATATTAGAAGAAAGCAAACTGCCATACAATAAT
	TTTCAGTTTCCAAGGCAACCAAGTGGAGAACACATCACAGGAGACAGGAAATATGGCTTGTTCATAGAATGATGCTACTGTGACTTCAAAACTGATCTCA
	AGTATTCTAGAATCTGCTGGGACATTGGGCTGTTTCTCAACTTATGTGTCTACTTGGAGAGAAAAGAATGTCTTTGAACAAAATGGCTAACTTTCACAAA
	ACTGTCTTGCCTCTTTTAAACATTACACTTGATACGAGAAATATGGCTTAAGAACACATGATGTCTCAGAAGGCCCATGCGCACACCAGACCGCTGTCTT
	AGTACTGTCACTGTTGTAAAGGCACATGTTGGAACACATCCAGTCCTGCTGACCTGTAGATAATTATTTTTCTCTAAATGAACTGTACATTTATCTTAAA
	TAAAAATTTATTTTTGAGATAACTGTT

Links between exon parts

From
exon
To
exon
Splice
sites
SupportExamples
13+3dbEST_BB625757.1,ENSMUST00000164509,GB_AK136838.1,
23+1ENSMUST00000164746,
34+37dbEST_AA444716.1,dbEST_AI787772.1,dbEST_AW211117.1,dbEST_BE985363.1,REF_NM_001161420.1,REF_NM_013703.2,GB_AK136838.1,GB_AK044683.1,GB_AK076172.1,GB_U06670.1,GB_BC013622.1,GB_L33417.1,
46+35dbEST_AA444716.1,dbEST_AI787772.1,dbEST_AW211149.1,dbEST_AW211117.1,REF_NM_001161420.1,REF_NM_013703.2,GB_AK136838.1,GB_AK076172.1,GB_U06670.1,GB_BC013622.1,GB_L33417.1,
45+2dbEST_BF466075.1,ENSMUST00000163729,
67+38dbEST_AI787772.1,dbEST_AW211149.1,dbEST_AW211117.1,dbEST_AW211303.1,REF_NM_001161420.1,REF_NM_013703.2,GB_AK076172.1,GB_U06670.1,GB_BC013622.1,GB_L33417.1,
68+8dbEST_BE985363.1,dbEST_BE981910.1,dbEST_DT929335.1,dbEST_DT924234.1,GB_AK136838.1,
78+36dbEST_AI787772.1,dbEST_AW211149.1,dbEST_AW211117.1,dbEST_AW211303.1,REF_NM_001161420.1,REF_NM_013703.2,GB_AK076172.1,GB_U06670.1,GB_BC013622.1,GB_L33417.1,
89+20dbEST_BF162494.1,dbEST_BI408034.1,dbEST_BI852705.1,dbEST_BI986139.1,REF_NM_001161420.1,REF_NM_013703.2,GB_AK136838.1,GB_AK076172.1,GB_U06670.1,GB_BC013622.1,GB_L33417.1,
910+18dbEST_BF162494.1,dbEST_BI852705.1,dbEST_BI986139.1,dbEST_CD803121.1,REF_NM_001161420.1,REF_NM_013703.2,GB_AK136838.1,GB_AK076172.1,GB_U06670.1,GB_BC013622.1,GB_L33417.1,
1011+21dbEST_BE569247.1,dbEST_BF162494.1,dbEST_BI852705.1,dbEST_BI986139.1,REF_NM_001161420.1,REF_NM_013703.2,GB_AK136838.1,GB_AK076172.1,GB_U06670.1,GB_BC013622.1,GB_L33417.1,
1113+2dbEST_CO425683.1,ENSMUST00000165761,
1112+21dbEST_AI035745.1,dbEST_AI036605.1,dbEST_BE569247.1,dbEST_BF162494.1,REF_NM_001161420.1,REF_NM_013703.2,GB_AK136838.1,GB_AK076172.1,GB_U06670.1,GB_BC013622.1,GB_L33417.1,
1213+20dbEST_AI035745.1,dbEST_AI036605.1,dbEST_BE569247.1,dbEST_BI852705.1,REF_NM_001161420.1,REF_NM_013703.2,GB_AK136838.1,GB_AK076172.1,GB_U06670.1,GB_BC013622.1,GB_L33417.1,
1314b+2dbEST_CX563049.1,ENSMUST00000025866,
1314a+17dbEST_AA072876.1,dbEST_BE569247.1,dbEST_CF745399.1,dbEST_CO425683.1,REF_NM_001161420.1,REF_NM_013703.2,GB_AK136838.1,GB_AK076172.1,GB_U06670.1,GB_BC013622.1,GB_L33417.1,
14b15+22dbEST_AA450865.1,dbEST_CB525740.1,dbEST_CF745399.1,dbEST_CF734286.1,REF_NM_001161420.1,REF_NM_013703.2,GB_AK136838.1,GB_AK044683.1,GB_AK076172.1,GB_U06670.1,GB_BC013622.1,GB_L33417.1,
1516+21dbEST_AA450865.1,dbEST_CB525740.1,dbEST_CF745399.1,dbEST_CF734286.1,REF_NM_001161420.1,REF_NM_013703.2,GB_AK136838.1,GB_AK044683.1,GB_AK076172.1,GB_U06670.1,GB_BC013622.1,GB_L33417.1,
1617+20dbEST_AA450865.1,dbEST_BF135892.1,dbEST_CB525740.1,dbEST_CF745399.1,REF_NM_001161420.1,REF_NM_013703.2,GB_AK136838.1,GB_AK044683.1,GB_AK076172.1,GB_U06670.1,GB_BC013622.1,GB_L33417.1,
1718+18dbEST_BF135892.1,dbEST_CB525740.1,dbEST_CF734286.1,dbEST_CX729472.1,REF_NM_001161420.1,REF_NM_013703.2,GB_AK136838.1,GB_AK044683.1,GB_AK076172.1,GB_U06670.1,GB_BC013622.1,GB_L33417.1,
1819+6dbEST_AA020307.1,dbEST_CB525740.1,ENSMUST00000167487,REF_NM_013703.2,GB_U06670.1,GB_L33417.1,
1820b+11dbEST_AA207904.1,dbEST_BF135892.1,dbEST_BI149643.1,dbEST_CX206580.1,REF_NM_001161420.1,GB_AK044683.1,GB_AK076172.1,GB_BC013622.1,
1920b+6dbEST_AA020307.1,dbEST_CB525740.1,ENSMUST00000167487,REF_NM_013703.2,GB_U06670.1,GB_L33417.1,
20b21+22dbEST_AA207904.1,dbEST_AA020307.1,dbEST_AA387354.1,dbEST_AI155932.1,REF_NM_001161420.1,REF_NM_013703.2,GB_AK136838.1,GB_AK044683.1,GB_AK076172.1,GB_U06670.1,GB_BC013622.1,GB_L33417.1,
2122+32dbEST_AA020307.1,dbEST_AA387354.1,dbEST_AA427202.1,dbEST_AI155932.1,REF_NM_001161420.1,REF_NM_013703.2,GB_AK136838.1,GB_AK044683.1,GB_AK076172.1,GB_U06670.1,GB_BC013622.1,GB_L33417.1,