NIA Mouse Gene Index (mm92)

Exon structure for U019667

chrX +

Exon1a 7339702 - 7340186
	GGCTTAGGGCGGGCTCTCCAATCTCCCGGCTGCAACTGGCTGCCTTGCTCAGGAGGTATGGCCCAACCAGACTTCCATCCCCAGTGTGGTCACTTCCTGT
	GGAGTTTCCCCAGCCCAAGGAGGAGGGGGAAGAGGACGAGAGGGAGGCGAGCGGTCGTTCGGGGTTAGGTTGGGGGGTGTCGGTCCGTTCAGGGCGGGTG
	ATGACTCACGGCCCATCCCATCTTCCCGACGCCGCCCGCCCACGCAGTGCTAGCTCCATGGCTTAACGGAGGAGGCAGCGGCAAACAGGGGGAGGGGGAC
	TCTTATTTTGTTAGGGGGACCGGGCCAAGGCCCGACCGGCCTGGCAGGGCTCGCCCGGAGCCGGGCGTCATGTCTCATGCAGCCGAGCCAGCTCGGGACG
	CCGTAGAGGCCAGCGCGGAGGGCCCTCGAGCCGTGTTCCTGCTATTGGAAGAGCGCAGGCCAGCTGAGTCGGCCCAGCTGCTCAG
Exon1b 7340187 - 7340339
	GTGCGGGGCCACCTCTGGGGCCGGGAGTGACAACTGAGGTTCCCCGGGGACTCATCTCAGGACACGGGGGGTCCTCGACTGGGGTTGGAGACTCTTGGCC
	TAGGCTTGAAGGACGTCGGAGTGCCCATCTTGGGTGGGCGCCTCAGAAATCTG
Exon2a 7341075 - 7341084
	CCGGTCTCTC
Exon2b 7341085 - 7341124
	AGTTCCCGGGTGTAATCTTGAATCAGTCTCTAGAGCTGGA
Exon2c 7341125 - 7341154
	GTGAGTACCGATTGCACCATTCCCGTCTGG
Exon3 7341167 - 7341286
	TCTCTCCTTTTCGGCTCCTCTCACCTCCATCAGCCTTGCTTTGAAGCTCCAGGCCTTCCTTGTCCATAGCCCTGCCCTCTCCAGCCCCCACCTTTTTCAA
	CTTAACGTGCAGTGGTGTGT
Exon4 7342633 - 7342746
	CCTGAATTCTTTGCTTCCGGAATCCGGGATTGTTGCTGATATCGAGTTAGAAAACATCCTCGATCCTGACAGCTTCTACGAGCTCAAAAGCCAACCCCTA
	TCCCTCCGCTCCAG
Exon5a 7343681 - 7343699
	CCTCCCAATATCACTGCAG
Exon5b 7343700 - 7343745
	GCCACACCGACCACCCCAGCTACACTCTCTGCGTCGTCTTCTGCAG
Exon5c 7343746 - 7343981
	GGGGCTCCCGGACCCCTGCCATGTCATCTTCTTCATCACGGGTCTTGCTGCGTCAGCAGCTTATGAGGGCCCAGGCTCAGGAACAGGAGAGGCGTGAGCG
	GCGGGAACAGGCAGCGGCCGCTCCCTTCCCCAGCCCTGCGCCCGCCTCACCAGCCATCTCTGTGATTGGCGTGTCTGCTGGTGGCCACACACTGAGTCGT
	CCACCTCCTGCTCAGGTGCCCAGGGAGGTACTCAAG
Exon5d 7343982 - 7344564
	GTAAGGACAGATCCAGAAGCTCTGGGACCCAGTGACTCAAAGGAGCTAAGAGGTTACCCAGGGTCCTCATGGCTTTTGGACCCAGTGACTCATAGGAGCT
	AAGAGGTTACCCAGGGTCCTCATGGCTTTTGGACAGGATCTGTATGGTTCTAAGGACAATTTGTGATAGTGTTTAAATGGTCTGCTGTTGTGCCCTGGGT
	GTTTATGGTTTCTTAGGCTTTCTTCTGTACCTGTGATGAATATTTTGCCTATTGGGATGTCTAGGGGAGGCATTGGTGTTATAGTTCATGGTTCTGTTGG
	GTGTTGTCTGAGACGTAGCAGGGAGCCCTGAGGATTCTGACAAGGTGATCTAGAAACTGACGGAACTTATCAGCCCTGGAAAGATTTTGGAGGCTGTAAA
	GGATTTCTGGAAAAAGAAGTTTGGGGTCTTGGGGAGATCTAATATTTCTGCAATGTTCTCAAATTCCAGGCCCTGTTGGTCCACATGAGCCTAAAAATAG
	TTGAGTTACAGGCTGGGGCTCAGAGTTCCTTCTTTGAGCTCTTTTGTGCCTTCTCTCCTTCCCCATGGCCTTTTATCTCACAG
Exon5e 7344565 - 7344810
	GTTCAGACCCACCTCGAGAACCCTACACGCTACCACCTGCAGCAAGCTCGCCGGCAGCAGGTCAAACAGTACTTGTCTACCACACTTGGGCCCAAGCTGG
	CTTCCCAGGCTCTCACCCCACCACCAGGGCCTTCCAGTGCCCAGCCACTTCCTGCCCCTGAAACTGCTCATGCCACCGGTCCTACAGGCAGTGCTCCTAA
	CAGCCCCATGGCGCTGCTCACCATTGGGTCCAGCTCAGAAAAGGAG
Exon6 7345019 - 7345123
	ATTGATGATGTCATTGATGAGATCATCAGCCTGGAGTCCAGTTACAACGATGAGATGCTCAGCTATCTTCCAGGAGGCACTGCAGGGCTGCAGCTCCCCA
	GCACG
Exon7a 7346556 - 7346590
	CTGCCGGTGTCTGGAAATCTACTTGATGTGTACAG
Exon7b 7346591 - 7346673
	CAGTCAGGGAGTGGCTACCCCAGCTATCACCGTCAGCAATTCCTGTCCAGCTGAGCTGCCTAACATCAAACGCGAGATCTCCG
Exon7c 7346674 - 7347899
	GTAAGTGTTAGGGACTTGGCCCTTTATCCCACCCTGTCCTGCCCTGTCACAACCAGAGCTGGAGCTAGGTCTAGTTCTAGGGAAGGGGTTTGAACTTTTC
	AGAAACGGGTTGAGGCTGGGGCTGGGAGGGTAGCTTAGAGTCTGTTAGACTCTACTGGGGTGCTTCTATCCCAAGCACCCCAGAGAAGCAAAGACAGTTG
	CTTTCCCTTTTTTTTGTTTTTTGTTTTGTTGTTTTTATCTCATGGCTCTTGGTCTGACTTTCACATTGTTTTCTCTGACTTCCTCTTATCTTGGGTGTAA
	CAGAAGGCCTGTGCCACCCCAGTTTCATTTTAAAAAGTAGCAAAGAGAGACATTTTACTTATTTATTTAttttttgagacatagcttcactctatagcct
	aggctgacctcaaattcccaacagctctcttgctggggcctcccgagtgctgaaactacagagctatgtacaaatgcccagctctggaactccctatata
	gcccaggctggcattgaacttggagcaatcttcctgcctctccttacaatgcttggattataggcatgaactaccatgcctggctCAAGACATCTTTTAA
	AACAATCAACAACAgtatggtggtccatgattgtggtcccagcacttggaagacagtatgggctatggctacgtattgaggccctgtctcaaaaaaagaa
	gaagaaaaagaggagaagaagaaagaggagaaacagaaacatcaaaagaagaagaaaaagaagaCAACAACAgggctggagagatggctcagaggttaac
	agcactggctgttcttccagagctcctgggttcaattcccagcattcacatggtggctcacaaccatctgtaactcaagttccaggggatccactgtcct
	cttctgagttccttgggtgccagacatgcacatggtgtgtattcgcaatgaaggcaaaacatccataaagagaaaataaaaataaaTGTAGTTTTTAAAA
	AGAAATCACTCCCAAGTCTGGCCCTGAGGCCAAACTGtgtagttacagctaatttggagactgtcaaggaggatggcttaagtcaggtgttcaaggccag
	cctggatgagaaagcaagatcccatctcaGCTTCTGTCCCTCTCCCACTAGCCCCTACCTCTGCATCTGCAGTGACTCTGCTTCCTATATCCAGAAGCCC
	TGATACCCACCCTCACTCTCTTCCAG
Exon7d 7347900 - 7347956
	AAACCGAGGCAAAGGCCCTTTTGAAGGAGCGACAGAAGAAAGACAATCACAACCTAA
Exon7e 7347957 - 7348120
	GTAAGCCGCAGAGCAGGCGCACTTGCCCACCCGCCACACAGCCCTGCCGTGCTCCTGCTTCAAGGGCCGCCTTCCATGGGGAGCCTCCCAGCGCCCCTGA
	TCCTCTCCCTTCCTTCACCCATTGATGACTCCTACTCTTTCTTTTTCTCCCCCTCTCTTGAAAG
Exon7f 7348121 - 7348196
	TTGAACGACGCAGGCGATTCAACATTAACGATAGGATCAAAGAGCTGGGCACCCTCATCCCCAAGTCCAATGATCC
Exon7g 7348197 - 7348447
	GTGAGTCTGGGCTGGGGACCCCAGGCCAATGGGAGGTGGAAGGAGCATCCTGGACCAGGAAAGTTGTTCCTTGCTGTGTCTGCCATGTAGTCTTGCCCAG
	ACAAAACTTCTCTGagccagaggttgagactcatacctgtactcccagctttggggaggctggggcaggaggattgccatgagttcaagaccagcctggg
	ctatatagtaagctctaggctatcctgggctacagagtgagactctgcatc
Exon7h 7348448 - 7349574
	aaaaaaaaaaaaATACTTCCCCACCCCCAAAAGAGCTCTCTGTCTTTCTTACCTTAGCTGGGGACGGTAGACCTTCCGACTTTGAATCCACAGTGTTAAG
	TTCGTCTGGCCTATCTGCACGCTGTGGAGCATAAACACGAGTGTTCTGTTCATTTTGTACTTCTTTTGGGTAGTCAGGGTTCAGttattgcgcctttgct
	ttgtaccaggtactgtgctaggctctgaggacaccagagggaacaaaaggaaaaataccattgtcctttggatctgatgcctttaattgaggcaacacag
	ttaagacaaaATCCATGACATTCGTTTCTAATGAGGGTTGTGGAACAGAACGGaaccggcccatggtggtttatgcctattaattagcccagtgctcagc
	agtctgaggcaggaggatctagagtttgaggccagcctcaaaacaaaaggacGCAGGGGAACCGAAGAGCACACTCAGCAGTTAGGAAGACCCGGGTTta
	gttctcgttccaaggcatctgatacccttctctggcctccaggggcatcgggcaggacaggtgctatgggtgcatacacatacaggcaagcagaaGGAAG
	ATGAGTGGATGGTGTGATGGTGACAGTGGCTGCAGCAAGCATAGTAGGGCTGAGCAGGCCTCGGCTAGCCAGGACACACTTGAATAGAGAGCTGAAAAAA
	ACggagctctgtatgtagctaagcatagtgcttgcctaccacgtgcaaggccctccgttcattcccagcCCAGAACAGGAATGGGCAAGATTGAGGAGGC
	CATGTGGTGGAGGGAAAGCACTCTAGGTGCAGGGTTGTATCCGAGTACAGGGCTTGAGATGAAAATAGTTTCCTATGTTAACACTTGAGAGGCCAGCCTT
	GGCTGTCATGGAGGAAACGAGCCAAAAAGGGTCAGGAGGGCTTCTAGGTTTGGGGCTATAATGGCCGCCACTGGATGATTGCAAGCATAGGGTTTATCGA
	AAGCACTCTAACCCTTTGATTTACCTCGGATTCTGCCATGTGGTCAGGTATTCGCTCTGCGTGGTACAATCCCCCCTGCGAGTCACGTGTGCAGTATTCG
	ATCTCTCCCTCTTCTCGGGCCCCACAG
Exon7i 7349575 - 7349722
	GGAGATGCGCTGGAACAAGGGCACCATCCTGAAGGCATCTGTGGATTACATCCGCAAATTACAGAAGGAACAGCAACGCTCCAAAGACCTGGAGAGCCGG
	CAGCGGTCCCTGGAACAAGCCAACCGAAGCCTGCAGCTCCGGATTCAG
Exon7j 7349723 - 7350619
	GTTTGAGGAGAGAAAATTGGGAGGGTGACTGACACTTCTGCAGGTAGAGGCAGGCAAAGCACTGACCGGCTTTCCCTTTAGACAACCCAATTCAAATGAT
	GATGACATAAATACACAGCACAGCATTACCAAGAATAGTTAGGATAcctggcatggtgcttctctgctatgcctttcatcctaccattcaggagccagac
	agacgctgggggatctgtgggttcaagggccaaggccagactctgcctgtaaaaattagaaGTAAGAAACagatggtttcatggctcactgggtgctctt
	ccagagcactttaaaaaacaaaaacaaaaacaaaaaccaactgtctgtaactccagttccaggggatctgacgccctcttctggcctccacaggcattgt
	acccatgatgcatgtatgtgcaggcaaaacaccaatatacaacaaaaataaaTATTAAAAAAATAAAAGAGTCTCATctgggcatggtagcacatgcctt
	taattccagggtagcaggggaaggcagatctcttgagttcaaggccagacagggatacacagagaaaccctgtctGGGGGGGGGGGGTAGCAAAGAGATT
	CTCCAAATAGTAGTCTAATGTATGTCGCATATATGTTGACTTgtgctgtaataagagctgtatgccccttaactcatttaatttccagaaacagccatat
	gagagaaccttccattattgtaccattttacagaggaggactctggggctcagagactaagcataaaatttggcaagtagtgagggccagaggatgcatt
	ggaacctagtagcctggcCTTTCAATGAAGACACTCTTCTACCTGTGACGGGCTTTGCACCCCATCTTACTTTGTACCCACCCCTTCGTTTTTACAG
Exon7k 7350620 - 7352327
	GAGCTAGAACTGCAGGCCCAGATCCATGGTCTGCCAGTCCCTCCCAACCCAGGACTGCTCTCCCTAACCACGAGTTCGGTCTCTGACAGCCTCAAGCCAG
	AACAGCTGGACATTGAGGAGGAGGGCAGGCCTAGCACAACGTTCCATGTATCGGGAGGACCTGCCCAGAACGCTCCTCCACAACAGCCTCCAGCACCACC
	TTCGGATGCCCTTCTGGACCTACACTTTCCCAGCGACCACTTGGGAGACCTGGGGGACCCCTTCCACCTAGGGCTAGAGGACATTCTGATGGAGGAGGAG
	GGGATGGTGGGAGGACTGTCAGGGGGTGCCCTGTCCCCACTGCGGGCTGCTTCTGACCCCCTGCTTTCTTCAGTATCCCCGGCTGTTTCCAAGGCCAGCA
	GCCGCCGTAGCAGCTTCAGCATGGAAGAGGAGTCCTGATCAGGCCTCACTCCTCCCCCTGGATGAGACCCTGCCTTTTTTCCCTACCCTCCTGTGAGACT
	GTCCTGTCCAGGAAATCTGGGGGAAGAGGAGTTGCAATCAGGCCCCAACCCTGTAATAGGCAAGGAGGAGGAATCAGGTGAGGCCCTGCCCCCTTTCCAT
	TCGTGGGGAAGAAGGCAGGAGAGAGCTGGGAAATCACAGTTCATCACTTGAGCATCATAGCCTTACCCCTCGCCCCTGGTCCTACTCCTGCCTCGGTGAT
	AGAAGGAGGCAGGGTAAGGGTATGCCCCTGGCCACTAGAGATCCTTAGAAACAGGTCTCTGAAGGAAAGGAGATGCCAGGATGCTACTCCATTCCTTCTC
	TGGGAATTGCCAGTCCAACTTTTCCTGGCACTGGAAGAAAAAAAATAAGTGTCCCACCCCTGGAGGGTTAATCCCTATCTCTTCCTTTTGACCCCTGACT
	TGTTCTGGCAAGGAACAGAAGTAAGGGTGTGATCCAGCCCGTCCCCCTGGGACCCATCCCTTCTCTATAGGAAAAGCTCAGCGCAGGTATTACAGGTATG
	GAGGAATTACTAGGCTCTGATCTCCCATGTAGAGGCCCCAGTCCTAACCCTGACCCTTAGCAGGACACCGTGCAAGCATTCCATTCGGCAGGGAGGATCA
	GTTCCTTAGCTCCCTGCCTTAACCTAGGACCAACCTGGGACCTGACCTGTGAGGACTCTGTGCTGACCTTATTCTTGGGGAAGGGAACAGATTTTGACCT
	AGATCAAGTGTAACTTAGGTCCTCACCCTTGGGACGACCTTGCCTTTTCTGCCTTGAGGGGCAGTTTTGGGAGATGAAAGGGATTAGTGTGGACCCAGTC
	TAGGCACCCCAGTACTTCCCTTCACCTTGTAGAAAATGGTAATGAAAGGGCATGCCCAGGCTCTTTAGCAGCCCAGGGAAACAGAGAAGTCTCCCTTAAA
	GGCAGGGCCTGGGAGGAATGGTGGCAAAGGTATAATGTATCCGTGTTTTGTTTGTGAATTTTTTATTGAACCCACCCACTCAGATGCTAAGTCAACCCTG
	ACCTCTGCCCCATCCACACCATTCTCCATTCGAGAGACTACCCCTGTTTCAGAGCCAGTCCCCACCTAGTCCCGTCCCTGCCACCTACACCCAAGGTCTT
	CAGCTTTAAGTTGCTGGGGCCAGGCCCCGAGGAGGGTTTACTGAGGGGTCTGTAGGTTTGACTAAAATAATAAATGCTAGGCGTGTTTGATGCGCTTTTA
	ACTTTGGC
Exon7l 7352328 - 7352328
	A

Links between exon parts

From
exon
To
exon
Splice
sites
SupportExamples
1a2a+1dbEST_BF465744.1,
1a4+92dbEST_AA863689.1,dbEST_AA024351.1,dbEST_AA690605.1,dbEST_AI509141.1,REF_NM_001105196.1,REF_NM_172472.3,GB_AK139756.1,GB_BC056358.1,GB_BC063047.1,GB_AK144751.1,GB_AK145832.1,GB_AK144657.1,GB_AK154690.1,GB_BC051568.1,GB_AK159162.1,GB_BC032963.1,GB_AF510653.1,GB_AK150372.1,GB_AK153051.1,
1b4+3dbEST_BY734817.1,ENSMUST00000137467,GB_AK145029.1,
2b4+13dbEST_BF465744.1,dbEST_BY208269.1,dbEST_BY183616.1,dbEST_BY193546.1,
2c4+6dbEST_BY744286.1,dbEST_BY168835.1,dbEST_BY744895.1,ENSMUST00000115677,GB_AK151447.1,GB_AK152221.1,
34+5dbEST_BY209985.1,dbEST_BY209045.1,dbEST_BY195310.1,ENSMUST00000101695,GB_AK155883.1,
45c+1ENSMUST00000115680,
45a+85dbEST_AA863689.1,dbEST_AI838186.1,dbEST_AV511028.1,dbEST_AW741896.1,REF_NM_001105196.1,REF_NM_172472.3,GB_AK139756.1,GB_BC056358.1,GB_BC063047.1,GB_AK145029.1,GB_AK144657.1,GB_AK154690.1,GB_BC032963.1,GB_AF510653.1,GB_AK150372.1,GB_AK153051.1,GB_AK151447.1,GB_AK152221.1,GB_AK155883.1,GB_AK147405.1,
45b+22dbEST_AA690605.1,dbEST_AI509141.1,dbEST_AI849355.1,dbEST_AI426195.1,GB_AK144751.1,GB_AK145832.1,GB_BC051568.1,GB_AK159162.1,
5c5e+51dbEST_AW049558.1,dbEST_BE985473.1,dbEST_BE986654.1,dbEST_BF461971.1,REF_NM_001105196.1,REF_NM_172472.3,GB_AK139756.1,GB_BC056358.1,GB_BC063047.1,GB_AK144751.1,GB_AK145832.1,GB_AK145029.1,GB_AK144657.1,GB_AK089762.1,GB_AK159162.1,GB_AK150372.1,GB_AK153051.1,GB_AK151447.1,GB_AK152221.1,GB_AK155883.1,GB_AK147405.1,GB_S76673.1,GB_AK185744.1,
5e6+46dbEST_AI181489.1,dbEST_AW049558.1,dbEST_BE985473.1,dbEST_BE986654.1,REF_NM_172472.3,GB_BC056358.1,GB_BC063047.1,GB_AK144751.1,GB_AK145832.1,GB_AK145029.1,GB_AK144657.1,GB_AK154690.1,GB_AK159162.1,GB_AK150372.1,GB_AK153051.1,GB_AK151447.1,GB_AK152221.1,GB_AK147405.1,GB_S76673.1,GB_AK220116.1,GB_S57655.1,
5e7a+11dbEST_BF721911.1,dbEST_BF722892.1,dbEST_CK341614.1,dbEST_DV649169.1,REF_NM_001105196.1,GB_AK139756.1,GB_AK089762.1,GB_AK155883.1,
67b+2dbEST_CK343117.1,NIA_K0531F12-3,
67a+44dbEST_AI181489.1,dbEST_BE985473.1,dbEST_BE986654.1,dbEST_BE864061.1,REF_NM_172472.3,GB_BC056358.1,GB_BC063047.1,GB_AK144751.1,GB_AK145832.1,GB_AK145029.1,GB_AK144657.1,GB_AK154690.1,GB_AK159162.1,GB_AK150372.1,GB_AK153051.1,GB_AK151447.1,GB_AK152221.1,GB_AK147405.1,GB_S76673.1,GB_AK220116.1,
7b7d+54dbEST_AI181489.1,dbEST_BB486033.2,dbEST_BE864061.1,dbEST_BF722892.1,REF_NM_001105196.1,REF_NM_172472.3,GB_AK139756.1,GB_BC056358.1,GB_BC063047.1,GB_AK144751.1,GB_AK145832.1,GB_AK145029.1,GB_AK144657.1,GB_AK154690.1,GB_AK089762.1,GB_AK159162.1,GB_AK150372.1,GB_AK153051.1,GB_AK151447.1,GB_AK152221.1,GB_AK155883.1,GB_S76673.1,GB_AK220116.1,
7d7f+54dbEST_AI181489.1,dbEST_BE864061.1,dbEST_BF535798.1,dbEST_BI693082.1,REF_NM_001105196.1,REF_NM_172472.3,GB_AK139756.1,GB_BC056358.1,GB_BC063047.1,GB_AK144751.1,GB_AK145832.1,GB_AK145029.1,GB_AK144657.1,GB_AK154690.1,GB_AK089762.1,GB_AK159162.1,GB_AK150372.1,GB_AK153051.1,GB_AK151447.1,GB_AK152221.1,GB_AK155883.1,GB_AK147405.1,GB_S76673.1,GB_AK220116.1,
7f7i+45dbEST_AI181489.1,dbEST_AV587079.1,dbEST_BE864061.1,dbEST_BF535798.1,REF_NM_001105196.1,REF_NM_172472.3,GB_AK139756.1,GB_BC056358.1,GB_BC063047.1,GB_AK144751.1,GB_AK145832.1,GB_AK145029.1,GB_AK144657.1,GB_AK154690.1,GB_AK089762.1,GB_AK159162.1,GB_AK150372.1,GB_AK153051.1,GB_AK151447.1,GB_AK152221.1,GB_AK155883.1,GB_S76673.1,
7i7k+53dbEST_AV587079.1,dbEST_BF535798.1,dbEST_BI693082.1,dbEST_BQ570011.1,REF_NM_001105196.1,REF_NM_172472.3,GB_AK139756.1,GB_BC056358.1,GB_BC063047.1,GB_AK144751.1,GB_AK145832.1,GB_AK145029.1,GB_AK144657.1,GB_AK089762.1,GB_AK159162.1,GB_AK150372.1,GB_AK153051.1,GB_AK151447.1,GB_AK152221.1,GB_AK155883.1,GB_AK147405.1,GB_S76673.1,GB_AK191610.1,