NIA Mouse Gene Index (mm92)

Exon structure for U019671

chrX +

Exon1 7418490 - 7418526
	AGGGGACGCTGTGCTCTGGGAATGTTGATGTTTTCCA
Exon2 7418613 - 7418750
	TGCCGACGCCTCTGAGCTCAAACCTCGGGGAAAGTAAAGCATAGACTGGGAGCCGAAAGGAGAAGCTGGGAAGAAGGCTGCCGACTTTGAAATTCGAGGC
	GGAGGACTTGAGAACGAGCGCTCAACCCGGATTGGCCA
Exon3 7418963 - 7419251
	CCGAATCCCGGAACCAGGTAGCAGAGAGCTCGGCCGGCCTTGGAGGGAGACAAGGCTGCGACCAATCCGTCTCCGTACCGTCCCACTGGACTTCACATCC
	GGGATCTCCTCCTGGGCGTGACCCGCGTCCCGTCTGCGGTCCTCGAACCGGTGTCCTGATCTCTTTATCCAGGCCTTGCTGTTCCCGTCGTGCCTCGCGC
	ACGACCGTAGCCCCCTCATCCGGGTTCTCTCCCGGCGTTCTCCGCGTTTGCTTTGCTGTGGGGTACTTGGCGGTGCCGCCATGACTATT
Retained Intron 7419252 - 7419723
	CTCCCCAAAAAGAAGCCGCCACCTCCCGACGCCGACCCGGCCAACGAAccgccgccgcccgggccgctgcccccggcgcctcggcgcggTGCGGGTGTAG
	GCGTGGGTGGCGGCGGCACGGGTGTGGGCGGAGGAGAGCGCGACCGTGACTCCGGCGTCGTGGGGGCCCGTCCCCGGGCTTCGCCGCCACCTCAGGGCCC
	GCTCCCGGGGCCGCCTGGTGCTCTTCATCGTTGGGCACTGGCCGTGCCGCCTGGCGCAGTCGCGGGCCCTCGGCCACAGCAGGCTTCTCCACCTCCTTGT
	GGGGGCCCCGGTGGCCCCGGCGGCGGTCCTGGTGACGCTCTTGGTGCGACAACTGCGGGGGTGGGCGCGGCAGGGGTGGTGGTGGGCGTGGGTGGTACCG
	TGGGCGTGGGCGGCTGCTGCTCGGGGCCCGGGCACAGCAAGCGGCGGCGTCAAGCTCCCGGCGTTGGCGCAG
Exon4b 7419724 - 7419836
	TTGGCGGGGCCAGTCCGGAACGTGAAGAGGTCGGAGCGGGCTACAACAGTGAAGACGAGTATGAAGCTGCCGCAGCGCGAATCGAGGCCATGGATCCCGC
	CACTGTAGAACAG
Exon5 7433430 - 7433523
	CAGGAACACTGGTTTGAAAAGGCCTTGCGGGACAAGAAAGGCTTCATCATCAAGCAGATGAAGGAGGACGGTGCCTGTCTATTTCGGGCTGTAG
Exon6a 7444641 - 7444705
	CTGACCAGGTGTATGGAGACCAGGACATGCATGAGGTTGTTCGAAAGCATTGCATGGACTATCTG
Exon6b 7444706 - 7444792
	GTGAGATCCAAGGGAGGCCTTGGGGCAGCAGGAGGGTAGGGGGACCCCCGTTGCACACAAACCTTAATTTTCCAATCTATTCCACAG
Exon6c 7444793 - 7444949
	ATGAAGAACGCTGATTACTTCTCCAACTATGTCACAGAAGACTTCACCACCTATATCAACCGGAAGCGGAAAAACAACTGCCATGGCAACCACATTGAAA
	TGCAGGCTATGGCAGAGATGTACAACCGTCCTGTGGAGGTGTATCAATATAGCACAG
Exon6d 7444950 - 7444964
	GTACTTCTGTAGTGG
Exon7 7445049 - 7445197
	AACCTATCAACACATTCCATGGGATCCATCAAAATGAAGATGAACCCATCCGTGTCAGCTACCACCGGAATATCCACTATAATTCAGTGGTGAATCCTAA
	CAAGGCCACTATTGGTGTGGGGCTGGGCCTACCGTCATTTAAGCCAGGG
Exon8a 7449122 - 7449307
	TTTGCAGAGCAGTCCCTGATGAAGAATGCCATAAAGACATCAGAAGAGTCATGGATTGAACAGCAAATGCTGGAAGACAAGAAACGAGCTACAGACTGGG
	AGGCCACAAATGAGGCCATAGAGGAGCAGGTGGCTCGAGAATCTTACCTTCAGTGGCTGAGGGATCAAGAGAAACAGGCCCGCCAG
Exon8b 7449308 - 7449325
	GTCCGGGGACCCAGCCAG
Exon9 7450680 - 7450881
	CCCCGGAAAGCCAGTGCCACATGCAGTTCAGCCACAGCAGCAGCCTCCAGTGGCCTGGAGGAATGGACTAGTCGGTCCCCACGGCAACGAAGTTCAGCCT
	CGTCACCTGAGCACCCTGAACTGCATGCCGAGCTAGGCATTAAGCCCCCTTCCCCAGGCACTGTGTTAGCTCTTGCCAAACCTCCTTCACCCTGTGCACC
	AG
Exon10 7450966 - 7451079
	GTACAAGCAGTCAGTTCTCAGCAGGGGGTGATCGGGCCACCTCTCCTCTTGTGTCCCTCTACCCTGCTCTGGAGTGCCGGGCCCTCATCCAGCAGATGTC
	CCCCTCTGCCTTTG
Exon11a 7451356 - 7453066
	CAGGTCTGAATGATTGGGACGATGATGAGATCCTAGCATCGGTGCTGGCAGTGTCCCAACAGGAATACCTAGACAGTATGAAGAAAAACAAAGTGCACAG
	AGAGCCACCCCCAGACAAGAGTTGATGGACACCCAGGGACTGGACATCATTCCCGATCCCCCACTCCTGCCCTTTGATGCCACCCAAACttctttggctt
	tcttccctcttggcttccttcttttgtttcctcttttccttttttttttcCACTTCCCTCTGGCCGGCCCACCCATGCGCTCCATCCATCTCATCCCTGC
	CACCACCATTGGTCTCTGCCAGCTGAAGTGCCCTATTGCCCCCGCACAGCACCATCTCAGCATTCCACAGGGGACTCTGGAAAGGGTGCGGAAGGTAGGC
	AAGAGGCCCACAGAGACAGACCATCTGGCAGCCAGGCAGCCCCAGAAGAGAGACATTCAGACAAAGGAAGTCTTCTGCTCACCCTTCCTTAAAGATCAGA
	TAAACTTGTCATCCCTTCCCAGCAATGATGACAGGAAAATGGAAGTGGCAAGTTTTCCTTCTAGTATCCGAAGAATCTGAGCCTTCAATGTTAAAATTTT
	TCTTAATTAAAATGTGCTTTATTTCACAAAATCAACAAATCAAAAAGAATATTCATGGCAACGTTGGTCCTTTGAGGGTGGCATCTCTGGTTTGGAGCTA
	GGCAGGCTGGCCATGGGACAGAAAGGGCAGAAAAAAGATGGATTTCTGCTGTCTTTTGGCCCCTAGTTCCTTGGAAGGGCAAAGGCTATGAGGTAGAGGG
	AGGTGACAGGCATTGCAGGTGGCAGACTGACTTTGGACAGTGAGACCCTGACCTTGCTGCATTGCTTTGCCTTCACCACCGCTAGTCTGTTTGGAAGGCT
	TGAGGTGGGGTGTCTTGGGAAATTAGGGCCACTACCCAAGATTTGAATTTAGGGAGTGGGAGCAGCCTCAGCAGATGGGGCACCCGTGCACTGCAGGTGT
	TGACAAGATCCACCATCTGTAATGTCCTTGGCACAATAAAACCAAATGTCAGTTTCCCTGAGCAACTCTATTCTGTGTGGGACACGGGTGGATGGGCCTC
	TGGGAAGCACAGGATTTGCTTTGACCAGAGGTCTGCTTGTTCTCCAGTAGGTGCTCTCTGTAAGCTGGGGTTCATATTTGATCTTCTGTTTATTAAATTA
	ACTTCTTGTCTTGAGACTGATGGCAGAGAATCTCTAGAGCCCAGGTGGGTTAAGACTAACCTAACCCACATAACCAAGATTGTTTCTTAAAAGAACAAAA
	CCAACAACAACTCTACaactggtcgtggtcatgcctttgatcccagcactgaggagggcagaggcagaggtggatcttttgagttgcaggccagctgggc
	tatacagcaagacgcttttattaaaaaTCATAAACTTCAGAACCAAATCGACTGAAACTGAAGTCCCTACTCCCACCTACCATATTTGCATTAGGGAGCC
	TAGGGCTAATTTAAAGGACTGTATGAGCCAGAGGCCAAGACTGGTGTCTGAATTTCTACTCTCAACCTTAATGCTCATTCATTCTTGTGATAATCTGATG
	AAATAAGCAATCACTAATGAGTTCAGTGACCAGAGGTGGCCCTTGCCCAACTGGGTTTTAAACGTTGGAGGATGAAATGGCTAAATCCTTTTTTTGTTGT
	TTGTTCCTCAG
Exon11b 7453067 - 7453140
	GTCTGTTGACACCTCTGTCCATACCCCTGCTAGGGTTTGTAAAGCCCAGCTAGAGAAGGCTGGCTGGCCCTCAG
Exon11c 7453141 - 7453746
	GTTTCCTCAGAGCAGTCTTCTCCCACTCCCCAATGCCTCAGTGAGGTCCTTTCAGAAGAAGGCTGTGTAGGGTGGCCCTACGGTGAGGGTATGGCTTGCC
	CAGTGGGTGGCTacaggatatctgaaatacgtggtcaagcatgagcacgccaagagggttgattcatttcaaatctacctgccttgtctcactgtgtggc
	tttgggctctctttgactttaaagtgtcccatctgcaactacaggggtcattaatgtctgctacctcatgctctctgatttgtgagtattgacagagaat
	gtgtatggtcaataatgtactactgggaacagtacctggtacactcttagagcacaaatgttggGGTTCTTACCAGACTTTAGGGGTGGGGGTATTACCG
	TATTTTGTAAGTTTGTACCATTTGGCCTCAGCCTGACTCTTGCTACTCTTGGCTTTTACTTGCAATTTGCCCTAACCCTATCTTCAGCAAGACAAAGGGA
	TCACCTGAAAAAACCCTGTGTGATCCCATTGGCACTCTCCCTTCTGTCTACGACTATTCCGAAGAACTGTACTATAAATAAACTTCTGGGCTGGGGCTGT
	GATGCT
Exon11d 7453747 - 7453752
	TACTTA

Links between exon parts

From
exon
To
exon
Splice
sites
SupportExamples
12+2dbEST_BY100293.1,ENSMUST00000152899,
23+2dbEST_BY100293.1,ENSMUST00000152899,
4b5+41dbEST_AI427397.1,dbEST_AV583793.1,dbEST_BB611294.1,dbEST_BB658337.1,REF_NM_138604.2,GB_BC016529.1,GB_AK155131.1,GB_AK010750.1,GB_AK149777.1,GB_AK171874.1,GB_BC051111.1,GB_AK169921.1,GB_AK167226.1,
56a+47dbEST_AI427397.1,dbEST_AV583793.1,dbEST_BB611294.1,dbEST_BB658337.1,REF_NM_138604.2,GB_BC016529.1,GB_AK155131.1,GB_AK010750.1,GB_AK149777.1,GB_AK171874.1,GB_BC051111.1,GB_AK169921.1,GB_AK167226.1,GB_AF229642.1,GB_AK212697.1,GB_AK204980.1,
6a6c+40dbEST_AV583793.1,dbEST_BB658337.1,dbEST_BE307393.1,dbEST_BE912257.1,REF_NM_138604.2,GB_BC016529.1,GB_AK155131.1,GB_AK010750.1,GB_AK149777.1,GB_AK171874.1,GB_BC051111.1,GB_AK169921.1,GB_AF229642.1,GB_AK204980.1,
6c7+40dbEST_AA717850.1,dbEST_AA563166.1,dbEST_BB658337.1,dbEST_BE656208.1,REF_NM_138604.2,GB_BC016529.1,GB_AK155131.1,GB_AK010750.1,GB_AK149777.1,GB_AK171874.1,GB_BC051111.1,GB_AK169921.1,GB_AK167226.1,GB_AF229642.1,
6d7+1ENSMUST00000115667,
78a+39dbEST_AA717850.1,dbEST_AA563166.1,dbEST_BB658337.1,dbEST_BE656208.1,REF_NM_138604.2,GB_BC016529.1,GB_AK155131.1,GB_AK149777.1,GB_AK171874.1,GB_BC051111.1,GB_AK169921.1,GB_AK167226.1,GB_AF229642.1,
8a9+2ENSMUST00000115665,GB_AK169921.1,
8b9+43dbEST_AA717850.1,dbEST_AA423546.1,dbEST_AA469723.1,dbEST_AL360428.1,REF_NM_138604.2,GB_BC016529.1,GB_AK155131.1,GB_AK010750.1,GB_AK149777.1,GB_AK171874.1,GB_BC051111.1,GB_AK167226.1,GB_AF229642.1,GB_AK009620.1,
910+42dbEST_AA615701.1,dbEST_AV587855.1,dbEST_AV465826.1,dbEST_AV146264.2,REF_NM_138604.2,GB_BC016529.1,GB_AK155131.1,GB_AK010750.1,GB_AK149777.1,GB_AK171874.1,GB_BC051111.1,GB_AK169921.1,GB_AK167226.1,GB_AF229642.1,GB_AK009620.1,GB_AK209520.1,GB_AK180926.1,GB_AK199214.1,
1011a+13dbEST_AA726346.1,dbEST_AV510550.1,dbEST_BF139588.1,dbEST_BF165648.1,GB_AK155131.1,GB_AK167226.1,
11a11c+1GB_AK169921.1,