NIA Mouse Gene Index (mm92)

Exon structure for U020074

chrX +

Exon1 98835390 - 98835449
	AGTTCCGGCTTGTGTTGTTTCGGTCGAGGAGCCCTCGCCGCCATTTCAAGACAGTGAGAG
Exon2 98835557 - 98835661
	AACCATTCTTGTCAGTAGTGGCGGCAGTAGAAGTCAATTACCCCTTGTTCTATCTCAAGAAGCTCCAGATGGCGTCTTCCGTGGGCAACGTGGCCGACAG
	TACAG
Exon3a 98838315 - 98838344
	AACCAACGAAACGTATGCTTTCCTTCCAAG
Exon3b 98838345 - 98838495
	GGTTAGCTGAGTTGGCACATCGAGAATATCAGGCAGGAGATTTTGAGGCAGCTGAGAGACACTGCATGCAGCTCTGGAGACAAGAGCCTGACAATACTGG
	TGTTCTTTTATTACTTTCATCTATACACTTCCAGTGTCGAAGGCTGGACAG
Exon4 98839286 - 98839529
	ATCTGCTCATTTTAGCACCTTGGCAATTAAACAGAATCCCCTTCTAGCAGAAGCCTATTCGAATTTGGGAAATGTGTACAAGGAAAGAGGGCAGTTGCAG
	GAAGCAATCGAGCATTATCGACATGCCTTGCGGCTGAAGCCTGATTTCATTGATGGTTATATTAACCTGGCAGCAGCCTTGGTAGCAGCAGGTGACATGG
	AAGGAGCAGTACAAGCCTATGTCTCTGCTCTTCAGTACAATCCT
Exon5 98847479 - 98847547
	GATTTGTACTGTGTTCGCAGTGACCTGGGGAACCTGCTCAAAGCCCTGGGTCGCTTGGAAGAAGCCAAG
Exon6 98849315 - 98849460
	AAGGTTTCAGGTGGGTGAAACCTCCTATTCCATGCGTAAGGTGCCTCGCTGAAGGGAGCTCGAGGCCTGGATCTAGGGCAGACACACAACCTCCTCCTCC
	TCTTCCAGCAAGGAACGCACCGAAAAGTCACATGATGAGAAATATG
Exon7 98850963 - 98851079
	GCATGTTATTTGAAAGCAATTGAGACGCAACCAAACTTTGCAGTAGCCTGGAGTAATCTCGGCTGTGTTTTCAATGCACAAGGGGAGATTTGGCTGGCTA
	TTCATCACTTTGAAAAG
Exon8 98856591 - 98856670
	GCTGTCACCCTTGACCCAAATTTTCTGGATGCTTATATCAATTTAGGAAATGTCTTGAAAGAGGCACGCATTTTTGACAG
Exon9 98858698 - 98858893
	AGCTGTCGCAGCTTATCTTCGTGCCTTAAGTTTGAGCCCAAATCATGCGGTGGTGCACGGCAACCTGGCTTGTGTGTACTACGAGCAAGGCCTAATAGAC
	CTGGCCATTGATACCTACAGGAGAGCTATCGAACTGCAACCCCATTTCCCCGATGCTTACTGCAACCTAGCAAATGCTCTCAAAGAGAAGGGCAGT
Exon10 98859182 - 98859322
	GTTGCTGAAGCAGAAGATTGTTATAACACAGCTCTTCGTCTGTGTCCTACTCATGCAGACTCTTTGAATAACCTTGCCAACATCAAACGGGAACAGGGCA
	ACATTGAAGAGGCAGTTCGCCTGTATCGCAAAGCATTAGAA
Exon11 98859983 - 98860083
	GTCTTCCCAGAGTTTGCTGCTGCACATTCCAATTTAGCAAGTGTACTGCAACAGCAGGGCAAGCTGCAGGAAGCACTGATGCACTATAAAGAAGCCATAC
	G
Exon12 98862617 - 98862770
	AATTAGTCCTACATTTGCTGATGCTTATTCCAATATGGGAAACACTCTAAAGGAGATGCAGGATGTGCAGGGCGCTTTGCAGTGTTATACTCGTGCCATC
	CAGATTAATCCTGCCTTTGCTGATGCACACAGCAATCTGGCCTCCATTCACAAG
Exon13 98862855 - 98862956
	GATTCAGGGAATATCCCAGAAGCAATAGCTTCTTACCGCACAGCTCTGAAACTTAAGCCTGACTTTCCTGATGCTTATTGTAACTTGGCTCATTGCCTAC
	AG
Exon14 98863319 - 98863498
	ATTGTCTGTGATTGGACAGACTATGATGAGCGGATGAAGAAATTGGTTAGTATTGTAGCTGAGCAGCTAGAGAAGAATAGACTGCCTTCTGTCCATCCTC
	ACCATAGCATGCTGTACCCTCTTTCCCATGGCTTCAGGAAGGCTATTGCAGAGAGGCATGGGAATCTCTGCTTGGATAAG
Exon15 98865096 - 98865254
	ATTAATGTCCTTCATAAACCACCATATGAACATCCAAAAGACTTGAAGCTCAGTGATGGCCGATTGCGTGTAGGCTATGTGAGTTCTGACTTCGGGAATC
	ACCCTACTTCACACCTTATGCAGTCTATTCCAGGCATGCATAATCCTGATAAGTTTGAG
Exon16 98865370 - 98865459
	GTATTCTGCTATGCCTTGAGCCCGGATGATGGTACAAACTTTCGAGTGAAGGTGATGGCGGAAGCCAATCATTTCATTGATCTTTCTCAG
Exon17 98867787 - 98867912
	ATTCCTTGTAATGGAAAAGCAGCCGACCGCATCCACCAAGATGGAATTCACATCCTTGTGAATATGAATGGGTATACCAAGGGTGCTCGGAATGAGCTCT
	TTGCTCTTAGGCCAGCTCCTATTCAG
Exon18 98868382 - 98868552
	GCCATGTGGCTGGGCTACCCTGGGACTAGTGGTGCACTGTTCATGGATTACATCATCACTGATCAGGAAACTTCCCCAGCTGAAGTTGCAGAGCAGTATT
	CTGAGAAACTGGCTTATATGCCCCATACTTTCTTTATTGGTGATCATGCTAATATGTTCCCTCACCTGAAG
Exon19a 98868637 - 98868661
	GGATGTCTGAATTTTTTTCCATTAG
Exon19b 98868662 - 98868778
	AAAAAAGCAGTCATCGATTTTAAATCCAATGGGCACATTTATGATAATCGGATAGTTCTGAATGGCATCGATCTCAAAGCATTTCTCGATAGCCTACCCG
	ATGTGAAGATTGTCAAG
Exon20 98868881 - 98869051
	ATGAAATGTCCTGATGGAGGTGACAATCCAGACAGCAGTAACACAGCTCTTAATATGCCCGTTATTCCCATGAATACGATTGCAGAAGCAGTAATTGAAA
	TGATTAACAGAGGGCAGATTCAGATAACAATTAACGGATTCAGTATTAGCAATGGACTGGCGACTACACAG
Exon21 98871488 - 98871640
	ATTAATAATAAGGCTGCAACCGGAGAGGAAGTTCCCCGTACCATTATTGTAACCACCCGTTCCCAGTATGGGCTACCAGAAGATGCCATTGTGTACTGTA
	ACTTTAATCAGTTATATAAAATTGACCCATCTACCCTGCAGATGTGGGCAAAT
Exon22 98874048 - 98874300
	ATTCTGAAACGTGTGCCTAACAGCGTGCTTTGGCTGTTGCGTTTTCCAGCAGTAGGAGAACCCAATATTCAACAATATGCACAAAATATGGGCCTTCCCC
	AGAACCGTATCATTTTCTCACCTGTGGCTCCTAAAGAGGAGCATGTCAGGAGAGGTCAGCTGGCTGATGTCTGCCTGGATACTCCTTTGTGTAATGGACA
	CACCACAGGGATGGATGTTCTCTGGGCAGGAACACCCATGGTGACTATGCCAG
Exon23 98874563 - 98874686
	GAGAGACTCTTGCCTCTCGAGTTGCAGCTTCTCAGCTTACTTGTCTAGGATGTCTCGAGCTCATTGCTAAAAGCAGACAGGAATATGAAGACATAGCTGT
	GAAACTGGGAACCGATCTAGAATA
Exon24 98877495 - 98879690
	CCTGAAGAAAATTCGTGGCAAAGTCTGGAAACAGAGAATATCTAGCCCTCTGTTCAACACCAAACAATACACAATGGAATTAGAGCGACTTTATCTGCAG
	ATGTGGGAGCATTATGCAGCTGGCAACAAACCTGACCACATGATTAAGCCTGTTGAAGTCACCGAGTCAGCCTGAATAAAGACTGCGCACAGGAGAATTG
	CCCTATACCTGAGCCTCAACCTTCTGGGGGAAGGGAACTAGATAACATGCTTTGTGTGTATCTGTGTAGTTCTGTGTTGCAGACGGATGATATATAATGA
	TAATAGAATAGCACATTCAGACTTACTTCCTGCATGATAGGGAGAGACAAGAAAGAAGAAATGCTATTCCACAAGGAATCTCTTAGAGTTTTGCAGCAAA
	CAGGTGGTGCACAGGTCTGGAAGGTCTGGTCTCCCTTGGTCTTCCATGGGATGCTTAATGTGGAGGGGAGATAGAGATTAACCAGCCGTTTTGTGATGCC
	GTGGATTGATCAAGTCTTCTGATCCTTTTTTTTTTCTTTATATTTTGGGTTTTGGAGCTTTTAAAAATGTTTGCTTTCAGGTATTTTTACTCATGTGAAG
	TGATCTTGATTCTTCTGAGGTTTTAAACTAAAATGTTGCTTCCTGTTTTAGTGTCTGAACTCTGACAGGGTGACAGGGACCTTGCTGGTGTAGTCTTTTT
	ATAGGTTTTATAAACCACATGAGCCTATATCAGTCATTTTAGTGTCTGACCTAATGCTTGGCACTGTCAGTGCTTTGTTTAGATGATGACTTAAGACTTT
	TCAGCCTGTTTTACACACCCCAGCTCCCGTTAAATTCTCCTGTGACTGCTAACAAACCCATGTCTGCTTTCAGACATCCCAGGGTGTTTCTCTCGAACAT
	GCCATCTGGTGCCAAATGAAAATTCTTAGGAGTGAATATTAATCATGAAGGTCACAGTTGTGGTACTGTTATTGATAATAATATAGGGTTTTTTTCTGCC
	TAAGTTTTACCTGTTTCACCAGTGTTTCAGCCCTTGACTGCCCCTCCTATGCTGCTTCCAAAAGTAATAGTGTGATAAGATTTTTACCTTCCTTTCTAAA
	GTTTGTTTTTTTTTTAAAGTGAGTCCTGTTCTTCCCATTTCTTTCAGCAGAAATGAAATCCCAGGTAAGTATATAAGTATTCAAATGTTTGGTTAGTAAA
	TTACAGTTCTCTCCAGTACCTTAAATGGTGTTCACCGCTCTGAAGAAGCATCTCTATACAGGCAGTTATTTTATTTTTAGACTGTGTTAGAATGTCTGGA
	CTTAGCTTCAAACTCTATGGATTCGGCCTTGGTAGGGAATTGTACCACCACTTGGTTTGGACTACAAATTAAACATTGGCCCTCGCGGAGCTTGAGTTCT
	TCATGGTAGAAAACAGTTGCATTTCCGTAAAGGGTGGAGGGCTTGAGGCTTAAATATATGAGTATGTTTATACTGCTCTACTGCACTTAGACTCTCCACT
	CACAGATAAGTCTTGTCTGTTAGTAGTGCTGTAGATTAAGTCTTTCCAAAGCACCTAGGCAGTGCACCTATTCTGTAGTTGCAGCTATTGCCTGAATGTA
	CCTTAGCTGACAAATTATTGATAATTAAGAACTTGAATTTGTGATTCTTACTGCTAATTAAAACCTAAGCAAGAAGTCTCATGTAATTCTGATAGCAGAA
	TTGCATTGTGTGAACTGTGTAACTTTAGTAATGTAAATCAAGGAACATCAGTTAAGAGATTTCCTAATTTATTTTTTAACTGAATAAATATCAGTTAAAA
	GATTGCCAGCATGGTTACAGGTAAACTGATTTTCAGAATTCACTGAACTACTAAATGTGGGATTGGATAATAGACTTGGAGTGCCGCTGAGGCTGAGATC
	TGTGGCCATTTACATAGCACATCATTCCTCCTATAGGGATGAACTTTTTTTCCGACACAAAAAGTAGCCACTGCGGTTAAAGCTTTGCTTATTGTAACAG
	GCTTTTATTTCCAGGTAACCTATCTGTGGAAGACCTAATTCTGAATAGAGTAATAGATATTACTGGAAACTGATTTGTTTTTTTTTTCCTATTATACTCT
	GCTTTATTGAAAAAGTAAAGCATTTAAAATTGTGCTCCAGAAATTCAGATGTTGTCTTGCGATCTTTAAACAATAAAATGGATGATTTCCCCTTAA

Links between exon parts

From
exon
To
exon
Splice
sites
SupportExamples
12+20dbEST_BB613756.1,dbEST_BE915015.1,dbEST_BG295303.1,dbEST_BQ928681.1,GB_AK076418.1,
23b+49dbEST_AA792734.1,dbEST_AI226742.1,dbEST_AI788110.1,dbEST_AI789082.1,GB_BC037194.1,
23a+83dbEST_AA146400.1,dbEST_AA537833.1,dbEST_AA146275.1,dbEST_AA200168.1,REF_NM_139144.3,GB_AK076418.1,GB_AK163296.1,GB_BC025097.1,GB_BC057319.1,GB_BC055851.1,GB_AF363030.1,
3b4+125dbEST_AA792734.1,dbEST_AA146400.1,dbEST_AA537833.1,dbEST_AA146275.1,REF_NM_139144.3,GB_AK076418.1,GB_AK163296.1,GB_BC025097.1,GB_BC057319.1,GB_BC037194.1,GB_BC055851.1,GB_AF363030.1,GB_AK149194.1,
45+88dbEST_AI226742.1,dbEST_AI789082.1,dbEST_AI747800.1,dbEST_AI526612.1,REF_NM_139144.3,GB_AK076418.1,GB_AK163296.1,GB_BC025097.1,GB_BC057319.1,GB_BC037194.1,GB_BC055851.1,GB_AF363030.1,GB_AK149194.1,
56+3dbEST_CV558803.1,ENSMUST00000153979,GB_AK163296.1,
57+36dbEST_BE288045.1,dbEST_BI663409.1,dbEST_BU706625.1,dbEST_BU058356.1,REF_NM_139144.3,GB_BC057319.1,GB_AF363030.1,
67+1dbEST_CV558803.1,
78+52dbEST_BE376274.1,dbEST_BF722497.1,dbEST_BQ928409.1,dbEST_BU706625.1,REF_NM_139144.3,GB_BC057319.1,GB_AF363030.1,GB_BC038435.1,GB_BC048239.1,
810+1ENSMUST00000147635,
89+53dbEST_BE376274.1,dbEST_BF722497.1,dbEST_BI466106.1,dbEST_BU058356.1,REF_NM_139144.3,GB_BC057319.1,GB_AF363030.1,GB_BC038435.1,GB_BC048239.1,
910+74dbEST_AW259934.1,dbEST_BE910866.1,dbEST_BF722497.1,dbEST_BI466106.1,REF_NM_139144.3,GB_BC057319.1,GB_AF363030.1,GB_BC038435.1,GB_BC048239.1,
1011+77dbEST_AW259934.1,dbEST_BE910866.1,dbEST_BG172193.1,dbEST_BG964234.1,REF_NM_139144.3,GB_BC057319.1,GB_AF363030.1,GB_BC038435.1,GB_BC048239.1,
1112+76dbEST_AW259934.1,dbEST_BE910866.1,dbEST_BG172193.1,dbEST_BG964234.1,REF_NM_139144.3,GB_BC057319.1,GB_AF363030.1,GB_BC038435.1,GB_BC048239.1,
1213+69dbEST_BB856062.1,dbEST_BE910866.1,dbEST_BG172193.1,dbEST_BG964234.1,REF_NM_139144.3,GB_BC057319.1,GB_AF363030.1,GB_BC038435.1,GB_BC048239.1,
1314+61dbEST_BB856062.1,dbEST_BE910866.1,dbEST_BG964234.1,dbEST_BG975654.1,REF_NM_139144.3,GB_BC057319.1,GB_AF363030.1,GB_BC038435.1,GB_BC048239.1,
1415+38dbEST_AW107797.1,dbEST_BB856062.1,dbEST_BG975654.1,dbEST_BU705525.1,REF_NM_139144.3,GB_BC057319.1,GB_AF363030.1,GB_BC038435.1,GB_BC048239.1,
1516+43dbEST_AA170529.1,dbEST_AA172556.1,dbEST_AV471624.1,dbEST_AW107797.1,REF_NM_139144.3,GB_BC057319.1,GB_AF363030.1,GB_BC038435.1,GB_BC048239.1,
1617+43dbEST_AA170529.1,dbEST_AA172556.1,dbEST_AV471624.1,dbEST_AW107797.1,REF_NM_139144.3,GB_BC057319.1,GB_AF363030.1,GB_BC038435.1,GB_BC048239.1,
1718+50dbEST_AA170529.1,dbEST_AA172556.1,dbEST_AA111460.1,dbEST_AW107797.1,REF_NM_139144.3,GB_BC057319.1,GB_AF363030.1,GB_BC038435.1,GB_BC048239.1,
1819a+1dbEST_BI106942.1,
1819b+50dbEST_AA172556.1,dbEST_AA734502.1,dbEST_AW822879.1,dbEST_BB644459.1,REF_NM_139144.3,GB_BC057319.1,GB_AF363030.1,GB_BC038435.1,GB_BC048239.1,GB_AK045910.1,
19b20+51dbEST_AA734502.1,dbEST_AW260487.1,dbEST_AW911216.1,dbEST_BB644459.1,REF_NM_139144.3,GB_BC057319.1,GB_AF363030.1,GB_BC038435.1,GB_BC048239.1,GB_AK045910.1,
2021+45dbEST_AA734502.1,dbEST_AA990287.1,dbEST_AI881998.1,dbEST_AW260487.1,REF_NM_139144.3,GB_BC057319.1,GB_AF363030.1,GB_BC038435.1,GB_BC048239.1,GB_AK045910.1,
2122+37dbEST_AA990287.1,dbEST_AA822769.1,dbEST_AW260487.1,dbEST_AW911216.1,REF_NM_139144.3,GB_BC057319.1,GB_AF363030.1,GB_BC038435.1,GB_BC048239.1,GB_AK045910.1,
2223+46dbEST_AA822769.1,dbEST_AU079185.1,dbEST_BB646545.1,dbEST_BB688449.1,REF_NM_139144.3,GB_BC057319.1,GB_AF363030.1,GB_BC038435.1,GB_BC048239.1,GB_AK045910.1,GB_AK047095.1,
2324+46dbEST_AA518494.1,dbEST_AU079185.1,dbEST_BB646545.1,dbEST_BB688449.1,REF_NM_139144.3,GB_BC057319.1,GB_AF363030.1,GB_BC038435.1,GB_BC048239.1,GB_AK045910.1,GB_AK047095.1,